1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
A sample of carbon dioxide at RTP is 0.50 dm3. How many grams of carbon dioxide do we have?
prohojiy [21]

Answer:

0.924 g

Explanation:

The following data were obtained from the question:

Volume of CO2 at RTP = 0.50 dm³

Mass of CO2 =?

Next, we shall determine the number of mole of CO2 that occupied 0.50 dm³ at RTP (room temperature and pressure). This can be obtained as follow:

1 mole of gas = 24 dm³ at RTP

Thus,

1 mole of CO2 occupies 24 dm³ at RTP.

Therefore, Xmol of CO2 will occupy 0.50 dm³ at RTP i.e

Xmol of CO2 = 0.5 /24

Xmol of CO2 = 0.021 mole

Thus, 0.021 mole of CO2 occupied 0.5 dm³ at RTP.

Finally, we shall determine the mass of CO2 as follow:

Mole of CO2 = 0.021 mole

Molar mass of CO2 = 12 + (2×16) = 13 + 32 = 44 g/mol

Mass of CO2 =?

Mole = mass /Molar mass

0.021 = mass of CO2 /44

Cross multiply

Mass of CO2 = 0.021 × 44

Mass of CO2 = 0.924 g.

3 0
4 years ago
Which of the following molecules is nonpolar?
Dvinal [7]

Answer:

CO2

Explanation:

  • There are two types of molecules
  1. Polar
  2. Non polar

Non polar molecules are insoluble in water .

7 0
3 years ago
Hen the power goes off, Jack does not have a flashlight so he uses a glow stick to provide light but he wonders how he could imp
katrin [286]

Answer:

A

Explanation:

I study physics

6 0
3 years ago
Which number should go in the blank?<br> - H₂ + O2 -&gt; 2H₂O<br> O<br> 2<br> 3<br> 1
nydimaria [60]
2 is the number as you need to balance the equation
8 0
3 years ago
Which factor is most important to consider when evaluating a journal article about global warming?
Strike441 [17]

Answer:

Does the article contain facts or only opinions? - B)

7 0
3 years ago
Read 2 more answers
Other questions:
  • How does changing the amplitude affect the wavelength
    11·2 answers
  • It takes 208.4 kJ of energy to remove 1 mole of electrons from the atoms on the surface of rubidium metal. If rubidium metal is
    11·1 answer
  • Which of the following contains the same number of atoms as 4.032g of hydrogen atoms?
    15·1 answer
  • 25. What is the order of the types of nuclear radiation from lowest to highest energy?
    12·2 answers
  • The solubility of O2 in water is approximately 0.00380 g L-1 of water when the temperature is 25.0°C and the partial pressure of
    8·1 answer
  • Which statement correctly describes the phosphate ion, mc031-1.jpg? It is composed of one phosphorus atom and four oxygen atoms
    11·2 answers
  • Which commercial technology commonly uses plasmas?
    13·1 answer
  • 2. What group is Ballardium located? (Bu) *
    7·1 answer
  • Mistry- Unit 5 Test 1 33 of 50
    11·1 answer
  • The boiling point of water is 100ºC. The boiling point of acetone is 56ºC. Which statement about distilling a mixture of acetone
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!