1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
. Given the reaction 2HgO → 2Hg + O2 , how many moles of elemental mercury will be obtained by the decomposition of 1 mole of Hg
AveGali [126]

Answer:

one mole of HgO will give one mole of Hg.

Explanation:

Given data:

Moles of HgO = 1 mol

Moles of Hg = ?

Solution:

Chemical equation:

2HgO → 2Hg + O₂

Now we will compare the moles of Hg with HgO from balance chemical equation.

                  HgO   :     Hg

                    2       :      2

                     1       :      2/2×1 = 1 mol

So, one mole of HgO will give one mole of Hg.

6 0
3 years ago
Engineering applies blank And math to develop technology
Gre4nikov [31]

It applies science and math m8

brainliest pls

7 0
3 years ago
What is the correct name for Mn(NO3),
kupik [55]

Answer:

Manganese trinitrate or manganese(III) nitrate

Explanation:

6 0
3 years ago
based on the cause and effect relationship between the magnets, which phenomenon is the teacher modeling for her students.
faltersainse [42]

Answer:

Someone breaking up.

Explanation:

8 0
2 years ago
Exactly 15.0 g of a substance can be dissolved in 150.0 g of water what is the solubility of the substance in grams per 100 g of
Leokris [45]
<span>(15.0 g) / (150.0 g) x (100 g) = 10.0 g/100 g H2O </span>
5 0
3 years ago
Other questions:
  • What is meant by compression
    12·2 answers
  • In which process does a solid change directly into a vapor?
    9·1 answer
  • The carbon cycle has several sources including all of the following except:
    9·1 answer
  • Is a metal baking tray a conductor or insulator or a radiator
    12·2 answers
  • Given the amount of solute in grams and the volume of the solution in milliliters, how would you go about calculating the molari
    15·1 answer
  • Describe molecules *no plagiarism like google etc!*
    10·1 answer
  • What is the highest energy level of an atom with 37 electrons
    14·1 answer
  • Which sample is most likely to undergo the smallest change in temperature upon the absorption of 100 kJkJ of heat
    7·1 answer
  • What occurs in photosynthesis reaction
    12·1 answer
  • Explain how adding soap to water affects the surface tension of water.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!