1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
A negative change in entropy indicates that...
vovangra [49]

Answer:

B. the products have a smaller number of available energy microstates than the reactants.

4 0
3 years ago
Read 2 more answers
Calculate the volume of a 0.5M solution containing 20g of NaOH
Tju [1.3M]

Answer:

1L

Explanation:

First, let us calculate the number of mole present in 20g of NaOH. This is illustrated below:

Mass = 20g

Molar Mass of NaOH = 23 + 16 + 1 = 40g/mol

Number of mole =?

Number of mole = Mass /Molar Mass

Number of mole of NaOH = 20/40 = 0.5mol

From the question given, we obtained the following data:

Molarity = 0.5M

Mole = 0.5mole

Volume =?

Molarity = mole /Volume

Volume = mole /Molarity

Volume = 0.5/0.5

Volume = 1L

6 0
3 years ago
Read 2 more answers
pplication)Using multiple models simultaneously: This FNT refers to a processinvolving three moles of a diatomic gas (which beha
Fiesta28 [93]

Complete Question

Questions Diagram is attached below

Answer:

*  W=1142.86Joule

*  Q=997.7J

*  H=2140.5J

Explanation:

From the question we are told that:

Temperature T=337K

Pressure P=(60-55)Pa*10^5

VolumeV=(1.6-1.4)m^3*10^{-3}

Generally the equation for gas Constant is mathematically given by

\frac{P_2}{P_1}=\frac{V_1}{V_2}^n

 \frac{55*10^5}{60*10^5}=\frac{1.4*10^{-3}}{1.6*10^{-3}}^n

 n=0.65

Therefore

Work-done

 W=\int{pdv}

 W=\frac{55*10^5*1.6*10^{-3}*60*10^5*1.4*10^{-3}}{1-0.65}

 W=1142.86Joule

Generally the equation for internal energy is mathematically given by

 Q=mC_vdT\\\\Q=\frac{3*1*3.314*16}{1.4-1}

 Q=997.7J

Therefore

 H=Q+W

 H=997.7J-11.42.9

 H=2140.5J

5 0
3 years ago
How does adaption allow mice with the mutation to survive better in some areas
Debora [2.8K]

Answer: Mutations can cause instant adaptations, while natural selection is the process by which adaptations occurs over a series of generations. Adaptations are changes or processes of changes by which an organism or species becomes better suited for its environment. A mutation is an alteration of the DNA sequence.

3 0
3 years ago
Can anyone explain enzymes in a simple way?
Sedaia [141]
Enzymes are biological catalysts which means they accelerate chemical reactions.
Hope this helps :)
4 0
3 years ago
Other questions:
  • Assuming complete distribution, what is the molarity of 10 milligrams of lisinopril in 100 liters?
    12·1 answer
  • Because many substances dissolve in water, it is considered a universal solvent. Which property of water explains this phenomeno
    5·2 answers
  • Why is water an extraordinary substance!
    9·1 answer
  • What is the mass of the polypropylene in grams? Assume that 1 lbs = 453.952 grams. Drag and drop the
    9·1 answer
  • 200 feet in 30 seconds is what speed?
    15·2 answers
  • Veronica observes how the force of friction causes an object to slow down. She writes the following observation: When an object
    15·1 answer
  • HELP BRAINLIEST
    13·1 answer
  • Can someone help me please ?
    8·1 answer
  • Stronger acids are different than weaker acids because they are more likely to
    6·1 answer
  • Where are these chemical reactions happening?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!