1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
22-How many molecules are there in 4L of<br> oxygen at 500C° and 0.0658 atm
Rzqust [24]

Answer:

ssddssfrrrrftyggy6t6

7 0
3 years ago
How do scientist prevent biases from affecting their data?
Tpy6a [65]

Answer:

Answer should be D. Scientists ignore their own person feelings and interpret data objectively.

6 0
3 years ago
Read 2 more answers
How has the work of chemists advanced cancer treatment?​
jeyben [28]

Answer:

C

Explanation:

it wouldn't be A because that makes no sense

theirs no pill or any type of drug that can slow it down but their is a treatment plan for it

(It could be c or d)

6 0
3 years ago
Read 2 more answers
2 When enough heat is added to liquid water, it boils, and bubbles of water vapor rise to the surface and into the air. Which ty
Molodets [167]

Answer:

In the first paragraph, name a theme of Paul Laurence Dunbar's poem "Sympathy," and explain how it develops, citing specific examples

Explanation:

6 0
3 years ago
The estimate obtained from a sample of which size is likely to be closest to
zubka84 [21]

The answer is C, 85.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What most likely happens when water vapor cools? A. It changes into gas. B. It changes into liquid. C. Its temperature increases
    5·2 answers
  • Calcium lon<br> Protons:<br> Neutrons: 20<br> Electrons:<br> Mass:<br> *it’s an ion*
    10·1 answer
  • Water can resist a greater external force than ethanol can. Which statement best describes this difference? Water has less capil
    13·2 answers
  • Chloroform, CHCl3, was once used as an anesthetic. In spy movies it is the liquid put in handkerchiefs to render victims unconsc
    10·2 answers
  • The half-life of thorium-227 is 18.72 days. How many days are required for three-fourths of a given amount to decay?
    5·1 answer
  • 5.1 mol is equal to_____particles.
    13·1 answer
  • Compare How does the horse's average speed from 60 s to 120 s compare to its average speed from 120 s to 180 s?
    8·1 answer
  • Which statement accurately describes the energy of a block of ice?
    12·1 answer
  • (a) 7.56 0.375 +14.3103<br>​
    11·1 answer
  • (a) Give one function each of the following equipments
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!