1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
Which formula represents a hydrate compound?​
ivolga24 [154]

Answer:

H2O2

Explanation:

There's hydrogen and ox in the formula to represent

8 0
3 years ago
Compare and contrast the concepts of average mass and relative mass. Which one is more accurate, and why? Why is the one you did
Brut [27]

Answer:

Relative and average atomic mass both describe properties of an element related to its different isotopes.

Explanation:However, relative atomic mass is a standardized number that's assumed to be correct under most circumstances, while average atomic mass is only true for a specific sample.

4 0
3 years ago
Read 2 more answers
PLEASE! :( Two aqueous solutions of AgNO3 and NaCl are mixed. Which of the following diagrams best represents the mixture? For s
-BARSIC- [3]

Answer:

NaCl + Ag(NO₃) --> Na(NO₃) + AgCl

Explanation:

Chemical equation:

NaCl + Ag(NO₃) --> Na(NO₃) + AgCl

The given reaction represent the double displacement reaction. Anion and cation of both reactant exchange with each others.

The anion of sodium chloride(Cl⁻) combine with cation of silver nitrate Ag⁺ and  NO₃⁻ combine with Na⁺.

The third equation is correct while others are in correct.

Double replacement:

It is the reaction in which two compound exchange their ions and form new compounds.

AB + CD → AC +BD

SORRY CAUSE IDK IF THAT HELPED :(

5 0
3 years ago
Fill in the chart to describe and give examples of physical changes.
frosja888 [35]

Answer:

here are some examples of physical change!!!

Explanation:

-An ice cube melting into water in your drink.

-Freezing water to make ice cubes.

-Boiling water evaporating.

-Hot shower water turning to steam.

-Steam from the shower condensing on a mirror.

8 0
3 years ago
Read 2 more answers
Consider the following reaction.Cr2O3(s) + 3CCl4(l) 2CrCl3(s) + 3COCl2(g). When the green solid is mixed with the colorless liq
Elena L [17]

Answer:

The answer to your question is: letter B

Explanation:

Reaction

                 Cr2O3(s)   +   3CCl4(l)   ⇒  2CrCl3(s)  +   3COCl2(g)

From the information given and the reaction, we can conclude that:

Green solid = Cr2O3 (s)     "s" means solid

Colorless liquid = CCl4 (l)    "l" means liquid   and is the other reactant

Purple solid = CrCl3(s)        CrCl3 is purple and "s" solid

Then, as a green specks remains it means that the excess reactant is Cr2O3, so, CCl4 is the limiting reactant.

6 0
4 years ago
Other questions:
  • What are the 3 parts of a nucleotide
    5·2 answers
  • Why did it require two sodium atoms to complete the Na2O formula unit? Na has +2 charge and O has -1 charge. Na has +1 charge an
    14·2 answers
  • CAN YOU PLEASE HELP ASAP​
    10·2 answers
  • In what way do scientists think differently about rainbows than most people?
    8·2 answers
  • Hydrazine reacts with oxygen according to the following equation: N2H4(g) +O2(g) → N2(g) + 2 H2O(l) How many L of N2, measured a
    14·1 answer
  • Provide IUPAC names od the following compound.​
    15·1 answer
  • If there is sufficient water in the reaction system, how many grams of KOH can be produced from 22.2 g of K?
    11·1 answer
  • The metal aluminum coils in an air conditioner conduct thermal energy from inside the house and release it outside the house. Wh
    5·1 answer
  • What is the best description of how heat is transferred from deep in the earth to the surface?
    11·2 answers
  • Calculate how many moles of water molecules were produced in the combustion of ethanol in oxygen.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!