1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
What is the body systems main job
kati45 [8]
Which part of the body system are you talking about
7 0
3 years ago
What do coefficients in chemical equations tell you?
Juliette [100K]
More information ^^^
5 0
3 years ago
A solution of sodium hydroxide was titrated against a solution of sulfuric acid. How many moles of sodium hydroxide would react
jeka57 [31]

Answer:

2 mole of Sodium hydroxide reacts with 1 mole of Sulfuric acid

Explanation:

Write down the equation in the beginning with reactants and products:

NaOH + H₂SO₄ → Na₂SO₄ + H₂0

Now try to balance it. Try with Na first:

2NaOH + H₂SO₄ → Na₂SO₄ + H₂0

Na atoms are balanced. There are 6 Oxygen atoms on the right and 5 on the left. Balance by increasing the H₂O moles:

2NaOH + H₂SO₄ → Na₂SO₄ + 2H₂0

Check if H atoms are also balanced. They are. That means our final reaction is:

2NaOH + H₂SO₄ → Na₂SO₄ + 2H₂0

2 Moles of NaOH reacts with 1 mole of H₂SO₄

5 0
3 years ago
Which term is used to describe the variety of inheritable traits in a species? (4 points)
Nookie1986 [14]

Answer:

B Genetic diversity

Explanation:

6 0
3 years ago
Read 2 more answers
A jet airplane has a velocity of 1145 knots. A knot is 1 nautical mile (nm)/hr. A nautical
ra1l [238]

Answer:

589.038 m/s

Explanation:

i dont know if did this right tho

4 0
2 years ago
Other questions:
  • What’s the molar mass of Rb3n
    14·1 answer
  • To make a table of the elements, dimitri Mendeleev sorted the elements according to their?
    8·2 answers
  • How are the melting points and boiling points of molecular compounds usually different from those of ionic compounds
    6·1 answer
  • Referring to an activity series, which of the following combinations of reactants would not produce a successful single-replacem
    15·2 answers
  • How many moles of chlorine gas are in 1.2m^3 at room temperature and pressure?
    5·1 answer
  • What kind of reaction is this ? P+02
    7·1 answer
  • Limiting Reactant
    13·1 answer
  • SUMMARY: Write a 3-4 sentence summary about the Periodic Table.
    11·1 answer
  • Will give brainliest <br><br> What is ozone depletion in simple words
    10·2 answers
  • A scientist has two samples of a substance. Both samples have the same temperature. One sample has a mass of 10 g. The other sam
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!