1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
Calculate the theoretical yield of glycolysis and complete glucose breakdown
rusak2 [61]
Eukaryotic cells, the theoretical maximum yield of ATP generated per glucose is 36 to 38, depending on how the 2 NADH generated in the cytoplasm during glycolysis enter the mitochondria and whether the resulting yield is 2 or 3 ATP per NADH
6 0
3 years ago
The isotope \left.\begin{array}{r}212 \\ 83\end{array}\right? Bi has a half-life of 1.01 yr. What mass (in mg) of a 2.00-mg samp
anyanavicka [17]

Half-life is the length of time it takes for half of the radioactive atoms of a specific radionuclide to decay. A good rule of thumb is that, after seven half-lives, you will have less than one percent of the original amount of radiation.

<h3>What do you mean by half-life?</h3>

half-life, in radioactivity, the interval of time required for one-half of the atomic nuclei of a radioactive sample to decay (change spontaneously into other nuclear species by emitting particles and energy), or, equivalently, the time interval required for the number of disintegrations per second of a radioactive.

<h3>What affects the half-life of an isotope?</h3>

Since the chemical bonding between atoms involves the deformation of atomic electron wavefunctions, the radioactive half-life of an atom can depend on how it is bonded to other atoms. Simply by changing the neighboring atoms that are bonded to a radioactive isotope, we can change its half-life.

Learn more about half life of an isotope here:

<h3>brainly.com/question/13979590</h3><h3 /><h3>#SPJ4</h3>
5 0
1 year ago
Carbon-13 is an isotope. It has 6 protons and _____. 13 neutrons 7 neutrons 7 electrons 13 electrons
vovangra [49]

Answer:

7 neutrons

Explanation:

7 0
3 years ago
Read 2 more answers
PLEASE HELP WILL GIVE BRAINLIEST!!!!
Anna [14]

Answer:

\boxed{It\ will\ shift\ to\ create\ less\ of\ substance\ A}

Explanation:

If the concentration of any substance A in a dynamic equilibrium increases, The equilibrium will be  shifted to its opposite side so that Substance A can be created less and the substance opposite to A can be created more so that a "dynamic equilibrium" can again be established.

3 0
3 years ago
What is the rate of change in velocity
luda_lava [24]
The rate of change in velocity<span> is called acceleration.</span>
3 0
3 years ago
Other questions:
  • Consider two equal-volume balloons under the same conditions of temperature and pressure. One contains helium, and the other con
    14·1 answer
  • 4AI+30 2 &gt; 2AI2O3 What id the chemical reaction?
    12·1 answer
  • Using electron configurations, explain why the halogens readily react with the alkali metals to form salts
    6·1 answer
  • Which of these reactions are redox reactions and why?
    13·1 answer
  • You notice something is growing in a 100ml pot of liquid soap. You take 1ml of this liquid soap and perform a serial dilution an
    14·1 answer
  • Dalton’s Law CalculationA mixture of H₂, N₂ and Ar gases is present in a steel cylinder. The total pressure within the cylinder
    11·1 answer
  • Explain why children should not be forced to choose sides in a divorce situation, provide two responses
    5·1 answer
  • What name is given to this type of diagram
    10·1 answer
  • What is the relationship between plastic and gasoline?
    15·1 answer
  • A man of 450N covers an area of 0.015m² standing on his feet. Calculate the pressure exerted by his feet on the ground.​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!