1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
2 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]2 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
What are smart cancer treatments
natita [175]

Is a potential to provide effective treatment with fewer side effects than a traditional therapy.

3 0
3 years ago
When an electron falls from an excited state to ground state, is energy released or absorbed?
strojnjashka [21]

Answer:

Energy is released.

Explanation:

When an electron absorbs energy, it moves up into an excited state. When it releases energy, it will return to the ground state.

5 0
3 years ago
HELP HELP HELP HELP HELP
slavikrds [6]

In order to properly measure the displacement, the object must be completely submerged, however in the diagram the wood is floating. So the measured displacement will only be a fraction of what it actually is.

4 0
3 years ago
Consider the following reaction between calcium oxide and carbon dioxide: CaO(s)+CO2(g)→CaCO3(s) A chemist allows 14.4 g of CaO
sweet-ann [11.9K]

Answer:

Theoretical yield =26.03 g

Percent yield = 87%

Limiting reactant = CaO

Explanation:

Given data:

Mass of CaO = 14.4 g

Mass of CO₂ = 13.8 g

Actual yield of CaCO₃ = 22.6 g

Theoretical yield = ?

Percent yield = ?

Limiting reactant = ?

Solution:

Chemical equation:

CaO + CO₂   → CaCO₃

Number of moles of CaO:

Number of moles  = Mass /molar mass

Number of moles = 14.4 g / 56.1 g/mol

Number of moles  = 0.26 mol

Number of moles of CO₂:

Number of moles = Mass /molar mass

Number of moles = 13.8 g / 44 g/mol

Number of moles = 0.31 mol

Now we will compare the moles of CO₂ and CaO with CaCO₃ .

                  CO₂         :                CaCO₃  

                  1               :                 1

                 0.31           :              0.31

                CaO           :               CaCO₃  

                 1                :                 1

                 0.26         :              0.26

The number of moles of  CaCO₃ produced by CaO are less it will be limiting reactant.

Mass of CaCO₃: Theoretical yield

Mass of CaCO₃ = moles × molar mass

Mass of CaCO₃ =0.26 mol × 100.1 g/mol

Mass of CaCO₃ =  26.03 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 22.6 g/ 26.03 g × 100

Percent yield = 0.87× 100

Percent yield = 87%

Limiting reactant:

The number of moles of  CaCO₃ produced by CaO are less it will be limiting reactant.

7 0
3 years ago
What is the pOH value of 0.0000877 M HCL
vredina [299]

Answer:

pOH=9.9

Explanation:

pH=-log[H+]= -log[0.0000877]

=4.06

pOH+ pH=14

pOH=14-4.06= 9.91

8 0
2 years ago
Other questions:
  • 210.0 °C a gas has a volume of 8.00 L. What is the volume of this gas at -23.0°C?
    13·1 answer
  • WILL GIVE 50 POINTS PLEASE HELP!!!!!
    13·1 answer
  • What would happen if carbon -14 gained 1 proton and lost 1 neutron?
    11·1 answer
  • Which characteristics describe the genetic code of humans? Select three options
    8·2 answers
  • Melatonin is an animal hormone believed to have a role in regulating the sleep cycle: The structure of melatonin incorporates tw
    5·1 answer
  • What is thrust force
    10·1 answer
  • 1. What is the frequency of the following:
    10·1 answer
  • Nuclear reactions in a reactor produce a lot of thermal energy. That energy then flows and warms up water, which boils and produ
    7·2 answers
  • What is the complete ionic equation for the reaction between Na2SO4 and
    10·1 answer
  • Americium-241 undergoes fission to produce three neutrons per fission event. if a neutron-absorbing material is mixed in with th
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!