1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
Which molecule is pentanoic acid?
Lana71 [14]

Answer:

A

Explanation:carboxyli

7 0
3 years ago
It took batman 5 minutes to catch robin in the bat-mobile. If he traveled 45 km before catching him, how fast was he going?
Nataly_w [17]

Answer:

he going zoom zoom

Explanation:

7 0
3 years ago
A particular radioactive nuclide has a half-life of 1000 years. What percentage of an initial population of this nuclide has dec
Delicious77 [7]

Answer:

91.16% has decayed & 8.84% remains

Explanation:

A = A₀e⁻ᵏᵗ => ln(A/A₀) = ln(e⁻ᵏᵗ) => lnA - lnA₀ = -kt => lnA = lnA₀ - kt

Rate Constant (k) = 0.693/half-life = 0.693/10³yrs = 6.93 x 10ˉ⁴yrsˉ¹

Time (t) = 1000yrs  

A = fraction of nuclide remaining after 1000yrs

A₀ = original amount of nuclide = 1.00 (= 100%)  

lnA = lnA₀ - kt

lnA = ln(1) – (6.93 x 10ˉ⁴yrsˉ¹)(3500yrs) = -2.426

A = eˉ²∙⁴²⁶ = 0.0884 = fraction of nuclide remaining after 3500 years

Amount of nuclide decayed = 1 – 0.0884 = 0.9116 or 91.16% has decayed.

3 0
3 years ago
PLEASE HELP!!!!!!!!! 20 points! Which would be best categorized as heat transfer by convection? Usuing a heat blanket to get war
Ghella [55]
I'd say the correct answer is: Noodles rising and falling apart in boiling water.
3 0
3 years ago
Read 2 more answers
Of the following which element is the heaviest? helium argon lithium aluminum
Georgia [21]

Answer:

Lithium

Explanation:

it is the only metal listed.

5 0
3 years ago
Other questions:
  • The most highly concentrated hydrochloric acid is 12 M. What volume of a 12 M stock solution of HCL should be diluted in order t
    8·1 answer
  • For the formation of ammonia, NH3, the enthalpy of reaction is shown:
    10·1 answer
  • Can someone help me with this i don't understand it.
    8·1 answer
  • How did Dalton describe the relationship between atoms and elements? An element is made up of one kind of atom. Atoms are made u
    8·2 answers
  • _________ are elements of the same element that have a different _______________ due to a different number of _____________.
    8·1 answer
  • Which ion below is present in greatest concentration in a basic (alkaline) solution
    15·2 answers
  • H2O,NH4,CO2 এ কয়টি মুক্তজোড় বা বন্ধন জড়ো ইলেকট্রন রয়েছে?
    14·1 answer
  • The density of water is about 1.0 g/mL at room temperature. Briefly explain how the density of an aqueous solution at room tempe
    5·1 answer
  • Tính số nguyên tử oxi
    8·1 answer
  • Please help me on this question
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!