1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
The body metabolizes glucose (C6H12O6) by burning it with oxygen to produce carbon dioxide, water and energy. If 3 moles of gluc
zhannawk [14.2K]

Answer: 18g

Explanation:

1 mle of glucose combusts to give 6moles of CO2 and 6moles of H2O

C6H12O6 + 6O2-------- 6CO2 + 6H2O at STP.

Multiplying 6 by 3 moles we have 18 g of CO2

7 0
3 years ago
What are the 4 different types of bonds and how are they formed?
miv72 [106K]

There are four types of chemical bonds essential for life to exist: Ionic Bonds, Covalent Bonds, Hydrogen Bonds, and van der Waals interactions. We need all of these different kinds of bonds to play various roles in biochemical interactions. These bonds vary in their strengths.

To play a variety of roles in biochemical interactions, we require all of these diverse sorts of linkages. The tensile strength of these linkages varies. In chemistry, we consider the range of strengths between ionic and covalent bonds to be overlapping. This indicates that in water, ionic bonds usually dissociate. As a result, we shall consider these bonds from strongest to weakest in the following order:

Covalent is followed by ionic, hydrogen, and van der Waals.

To know more about 4 different types of bonds, visit;

brainly.com/question/17401243

#SPJ4

8 0
1 year ago
Convert 25 liters per hour to milliliters per second.
Dominik [7]

Answer:

6.94444

Explanation:

4 0
3 years ago
Read 2 more answers
How many Available electrons does CIO3, chlorate ion?
Natalija [7]
For, ClO3- there are 26 valence electrons, so total pairs of electrons are 13.
6 0
3 years ago
How many moles of H2SO4 are needed to completely neutralize 0.0164 mol KOH
Vanyuwa [196]
0.0082 You have to equal out the amount of concentration with the unknown
8 0
4 years ago
Read 2 more answers
Other questions:
  • Which actions conserve fossil fuels? Choose the two correct answers.
    10·1 answer
  • The enzyme, carbonic anhydrase, is a large zinc-containing protein with a molar mass of 3.00 x10^4 g/mol. Zn is 0.218% by mass o
    15·1 answer
  • How many milliliters of 0.50 M KOH are needed
    9·1 answer
  • Which formula id correctly paired with its name? A. MgSO↓ = magnesium chlorine
    6·1 answer
  • Lisa wants to determine which melts faster, an ice cube or a popsicle. What procedure should she follow to conduct her
    13·1 answer
  • Why in a stream containing water, the mole fraction of a given
    6·1 answer
  • What is the molality of a solution made by dissolving 3.71 g of sodium chloride in 0.535 L of water?
    7·1 answer
  • N a chemical reaction the ______of reactants and products are always equal.
    7·1 answer
  • A sample of a pure substance with a density of 3 g/mL is separated into two pieces. One piece has a mass of 50 g and the other p
    15·1 answer
  • Which layer of the atmosphere is between the mesosphere and the exosphere?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!