1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
Identify the type of igneous rock that is formed when magma cools above Earth's surface?
mylen [45]

Answer: cools down and keeps going

Explanation:

5 0
3 years ago
Find density of nitrogen dioxide at 75*C and 0.805 atm.
Eva8 [605]

Answer:

1 (348) (D2) = 273 (2.05) (0.805) D2= 1.29 g/L

Explanation:

5 0
4 years ago
Which of the following molecules are considered inorganic?
Oksi-84 [34.3K]
The answer is D water
7 0
2 years ago
Read 2 more answers
An objects tendency to maintain its current state of motion is called
daser333 [38]
Inertia is the tendency of an object to remain at rest or remain in motion. Inertia is related to an object's mass.
3 0
3 years ago
The question in the picture, I really a correct answer, no cheap answers​
Delvig [45]

Answer:

94.325 g

Explanation:

We'll begin by converting 350 mL to L. This can be obtained as follow:

1000 mL = 1 L

Therefore,

350 mL = 350 mL × 1 L /1000 mL

350 mL = 0.35 L

Next, we shall determine the number of mole of KC₂H₃O₂ in the solution. This can be obtained as follow:

Volume = 0.35 L

Molarity of KC₂H₃O₂ = 2.75 M

Mole of KC₂H₃O₂ =?

Molarity = mole /Volume

2.75 = Mole of KC₂H₃O₂ / 0.35

Cross multiply

Mole of KC₂H₃O₂ = 2.75 × 0.35

Mole of KC₂H₃O₂ = 0.9625 mole

Finally, we shall determine the mass of KC₂H₃O₂ needed to prepare the solution. This can be obtained as illustrated below:

Mole of KC₂H₃O₂ = 0.9625 mole

Molar mass of KC₂H₃O₂ = 39 + (12×2) +(3×1) + (16×2)

= 39 + 24 + 3 + 32

= 98 g/mol

Mass of KC₂H₃O₂ =?

Mass = mole × molar mass

Mass of KC₂H₃O₂ = 0.9625 × 98

Mass of KC₂H₃O₂ = 94.325 g

Thus, the mass of KC₂H₃O₂ needed to prepare the solution is 94.325 g

6 0
3 years ago
Other questions:
  • Typically, water runs through the baseboard copper tubing and, therefore, fresh hot water is constantly running through the pipi
    13·1 answer
  • Trigonal planars have a 180 degree bond angle but do bent trigonal planars also have a 180 degree bond angle? Thank you ^^
    7·2 answers
  • Calculate the molar mass of a compound from the following information. You find that the freezing point of benzene is 5.5 degree
    5·1 answer
  • Which of the following is most likely to yield the fossils that help scientists reconstruct the Earth's biological history?
    7·2 answers
  • Using ohm's law, explain how voltage changes in relation to current, assuming that resistance remains constant.
    11·1 answer
  • Reproductive health is important to take precaution against sit and unplanned Pregnancy​
    14·1 answer
  • Correct answer. 9. The mass number of an element is the number of? ​
    15·1 answer
  • Molarity of sodium ion in a solution made by mixing 3.66 mL of 0.261 M sodium chloride with 500. mL of 6.51 10-3 M sodium sulfat
    12·1 answer
  • When a predator population increases what happens to the prey population? Increase Decrease Dies Stays the same
    9·1 answer
  • Consider the unbalanced equation for the oxidation of butene. C4H8 + 6O2 Right arrow. CO2 + H2O For each molecule of C4H8 that r
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!