1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
3 years ago
7

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Chemistry
1 answer:
valentina_108 [34]3 years ago
3 0
TACCGAACGGTTCCAGGCCTTTCAAAG
You might be interested in
Write the ionic charges (such as Ca2+) and chemical formulas and fill-in the table below.
Vikentia [17]

1) Lithium and fluorine:

Ionic charges: lithium cation Li⁺ and fluorine anion F⁻.

Chemical formula LiF.

In ionic salt lithium fluoride (LiF), fluorine has electronegativity approximately χ = 4 and lithium χ = 1 (Δχ = 4 - 1; Δχ = 3).

Fluorine attracts electron and it has negative charge and lithium has positive charge.

2) Beryllium and oxygen:

Ionic charges cation Be²⁺ and anion O²⁻.

Chemical formula is BeO.

Beryllium is metal from group 2 and oxygen is nonmetal from group 16.

Electron configuration of beryllium: ₄Be: 1s² 2s², it has two valence electrons in 2s orbital.

Beryllium lose two electrons and to gain electron configuration as noble gas helium (He).

Electron configuration of oxygen atom: ₈O 1s² 2s² 2p⁴.

Oxygen gain two valence electron to form anion with stable electron configuration as noble gas neon (atomic number 10).

3) Magnesium and fluorine:  

Ionic charges cation Mg²⁺ and anion F⁻.

Chemical formula is MgF₂.

Magnesium fluoride (MgF₂) is salt, ionic compound.  

Magnesium (Mg) is metal from 2. group of Periodic table of elements and has low ionisation energy and electronegativity, which means it easily lose valence electons (two valence electrons).  

Magnesium has atomic number 12, which means it has 12 protons and 12 electrons. It lost two electrons to form magnesium cation (Mg²⁺) with stable electron configuration like closest noble gas neon (Ne) with 10 electrons.  

Fluorine (F) is nonmetal with greatest electronegativity, which means it easily gain electrons.  

Fluorine has atomic number 9, which means it has 9 protons and 9 electrons. It gain one electron to form fluorine anion (F⁻) with stable electron configuration like closest noble gas neon (Ne) with 10 electrons.  

4) Aluminum and chlorine:  

Ionic charges cation Al³⁺ and anion Cl⁻.

Chemical formula is AlCl₃.

The right name for AlCl₃ is aluminium chloride.

Aluminium chloride is a salt with ionic bonds.

Aluminium (metal from group 13) has oxidation number +3 and chlorine (nonmetal from group 17) has oxidation number -1, chemical compound has neutral charge (+3 + 3 · (-1) = 0).

5) Beryllium and nitrogen:  

Ionic charges cation Be²⁺ and anion N³⁻.

Chemical formula is Be₃N₂.

Atomic number of nitrogen is 7, it has 7 protons and 7 electrons.

Electron configuration of nitrogen atom: ₇N 1s² 2s² 2p³.

Nitrogen gain three electrons to form anion with stable electron configuration as noble gas neon (atomic number 10).

4 0
3 years ago
Calculate the volume in mL of a 0.708 M KOH solution containing 0.098 mol of solute
Olenka [21]
Molarity = mol/liter

0.708M = 0.098mol/L
Rearrange to find L:
0.098mol/0.708M = .138L

For every liter there is 1000 mL:
.138L • 1000mL =138mL KOH
7 0
3 years ago
What does it mean if you titrated the acid to a 'hot pink' color All of these
Murrr4er [49]

Answer: Too much base was added

i guessed

Explanation:

3 0
3 years ago
The vapor pressure of 25 milliliters of water at 25 degrees celcius will be the same as
Marysya12 [62]
15 degrees Fahrenheit
8 0
3 years ago
6 × 10^9 mm = m. how to convert millimeters to m​
OLga [1]

Answer:

6x10^9x10^-3m=6x10^6m

Explanation:

3 0
3 years ago
Other questions:
  • What is the change in enthalpy in kilojoules when 3.24 g of CH3OH is completely reacted according to the following reaction 2 CH
    7·1 answer
  • Given 8.25 g of butanoic acid and excess ethanol, how many grams of ethyl butyrate would be synthesized, assuming a complete 100
    10·1 answer
  • For an object that is speeding up at a constant rate, how would the acceleration vs. time graph look?
    14·2 answers
  • Which solution is a buffer? which solution is a buffer? a solution that is 0.200 m in h2so4 and 0.200 m in na2so4 a solution tha
    9·1 answer
  • Tell me the name please<br>​
    14·1 answer
  • Identify the element that cannot participate in nuclear fission reactions. (Hint: Think about the size of the atom.)
    7·1 answer
  • Define acidic salt with example​
    14·2 answers
  • What causes air to rise in the equator
    15·1 answer
  • Competition occurs when
    14·1 answer
  • The group of atoms that is responsible for the characteristic properties of a family of organic compounds is called a/an _______
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!