What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
1 answer:
You might be interested in
Answer:
1 ) Δs ( entropy change for hot block ) = - Q / th ( -ve shows heat lost to cold block )
Δs ( entropy change for cold block ) = Q / tc
∴ Total Δs = ΔSc + ΔSh
= Q/tc - Q/th
2) ΔSdecomposition = Δh / Temp = ( 181.6 * 10^3 / 773 ) = 234.928 J/k
Explanation:
<u>1) To show that heat flows spontaneously from high temperature to low temperature </u>
example :
Pick two(2) solid metal blocks with varying temperatures ( i.e. one solid block is hot and the other solid block is cold )
Place both blocks for time (t ) in an insulated system to reduce heat loss or gain to or from the environment
Check the temperature of both blocks after time ( t ) it will be observed that both blocks will have same temperature after time t ( first law of thermodynamics )
Δs ( entropy change for hot block ) = - Q / th ( -ve shows heat lost to cold block )
Δs ( entropy change for cold block ) = Q / tc
∴ Total Δs = ΔSc + ΔSh
= Q/tc - Q/th
<u>2) Entropy change for Decomposition of mercuric oxide </u>
2HgO (s) → 2Hg(l) + O₂ (g)
Δs = positive
there is transition from solid to liquid and the melting point of mercury ( the point at which reaction will take place ) = 500⁰C
hence ΔSdecomposition = S⁻ Hg - S⁻ HgO =
Δh of reaction = 181.6 KJ
Temp = 500 + 273 = 773 k
hence ΔSdecomposition = Δh / Temp = ( 181.6 * 10^3 / 773 ) = 234.928 J/k
Alkenes on reacting with ozone results in the formation of ozonide which undergo reductive cleavage in presence of dimethyl sulfide to form carbonyl compounds (aldehyde or ketone). Whereas in presence of hydrogen peroxide it undergoes oxidative cleavage to form carboxylic acids or ketones.
Since, A alkene yields 4-heptanone only on treatment with ozone and DMS thus, it implies that both the chains on the side of the double-bond are similar the product is 4-heptanone that means the double bond is present between the chains at the 4th carbon. Therefore the structure of compound A is 4,5-dipropyloct-4-ene.
The reaction is as shown in the image.
The reaction of A with m-CPBA (meta-perchlorobenzoic acid) followed by aqueous acid is shown in the image.
m-CPBA (meta-perchlorobenzoic acid) is a peracid and forms epoxides on reacting with alkenes.
