2 years ago

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

1 answer:

3 0

TACCGAACGGTTCCAGGCCTTTCAAAG

You might be interested in

spayn [35]

Answer:

I'm sorry, you didn't post the pictures.

4 0

2 years ago

Orlov [11]

Answer : The volume of 6M NaOH stock solution is, 16.7 mL

Explanation :

To calculate the volume of NaOH stock solution, we use the equation given by neutralization reaction:

$M_1V_1=M_2V_2$

where,

$M_1\text{ and }V_1$ are the molarity and volume of NaOH stock solution.

$M_2\text{ and }V_2$ are the molarity and volume of NaOH.

We are given:

$M_1=6M\\V_1=?\\M_2=0.2M\\V_2=500mL$

Putting values in above equation, we get:

$6M\times V_1=0.2M\times 500mL\\\\V_1=16.7mL$

Thus, the volume of 6M NaOH stock solution is, 16.7 mL

4 0

3 years ago

Anna007 [38]

I THINK that that is true. It's just weathering the rock down not change composition. Lemme know if you get it right please! (:

4 0

3 years ago

BigorU [14]

Answer:

when water changes from a liquid on earths surface to a gas in the atmosphere,this is known as evaporation

7 0

3 years ago

Alina [70]

C is the correct answer

6 0

2 years ago