What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
1 answer:
You might be interested in
Answer:
The number will appear to become smaller (from 5800 mL to 5.8 L).
Explanation:
The conversion of milliliters to liters is the following:
1 L = 1000 mL
Hence, the volume of 5800 mL to L is:
Therefore, the number will appear to become smaller (from 5800 mL to 5.8 L).
I hope it helps you!