Answer:
NO
Explanation:
Sunlight is an electro-magnetic wave not a substance therefore it does not have a chemical compound
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
the insertion on removal of mutations are dangerous in nature. the process is basically just one large gamble to see what it does. and even though we have a decent understanding of the genomes of many animals and plants, we still dont know everything. so if we tamper with certain genes we may cause a evolution or we might kill the subject and the potential for it to procreate.
Answer: 6CO2 + 6H2O -> C6H1206 + 6O2
Explanation: This is a balanced chemical equation for photosynthesis. In photosynthesis, six molecules of carbon dioxide react with six molecules of water in the presence of sunlight to form one molecule of glucose and six molecules of oxygen. Photosynthesis is a process by which green plants manufacture their own food using sunlight. Plants cells have an organelle known as chloroplast which contains chlorophyll a green pigment that traps energy from the sun. The energy trapped by the chlorophyll is used by plants in the presence of carbon dioxide and water to drive the synthesis of glucose with the release of oxygen as the by-products.