1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
3 years ago
7

Variations in elevation of a land surface is

Biology
2 answers:
RideAnS [48]3 years ago
7 0
<span>relief is your answer so yeah</span>
sergeinik [125]3 years ago
5 0

Variations in elevation of a land surface is relief (or terrain)

Relief also known as terrain is the variations in elevation of a land surface. The relief of an area is the difference in elevation between the highest and lowest dimensions of the area. Relief helps to indicate the direction, height, and angle of slope of many physical geographical features such as plains and mountains in a particular region on the earth surface.


You might be interested in
Does sunlight have a chemical compound?
zlopas [31]

Answer:

NO

Explanation:

Sunlight is an electro-magnetic wave not a substance therefore it does not have a chemical compound

8 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Why are insertion and deletion mutations so harmful?
Marta_Voda [28]

the insertion on removal of mutations are dangerous in nature.  the process is basically just one large gamble to see what it does. and even though we have a decent understanding of the genomes of many animals and plants, we still dont know everything. so if we tamper with certain genes we may cause a evolution or we might kill the subject and the potential for it to procreate.

3 0
3 years ago
_CO2 + _H20 -&gt; _C6H1206+ __O2
iVinArrow [24]

Answer: 6CO2 + 6H2O -> C6H1206 + 6O2

Explanation: This is a balanced chemical equation for photosynthesis. In photosynthesis, six molecules of carbon dioxide react with six molecules of water in the presence of sunlight to form one molecule of glucose and six molecules of oxygen. Photosynthesis is a process by which green plants manufacture their own food using sunlight. Plants cells have an organelle known as chloroplast which contains chlorophyll a green pigment that traps energy from the sun. The energy trapped by the chlorophyll is used by plants in the presence of carbon dioxide and water to drive the synthesis of glucose with the release of oxygen as the by-products.

7 0
3 years ago
The _____ remove excess water salts Utica acids and chemicals from the blood
Igoryamba

Answer:

kidneys

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • What dinosaur is found on almost every continent?
    8·2 answers
  • How do fungi benefit from being able to reproduce both asexually and sexually?
    11·1 answer
  • The scientific method uses observation and which other process to answer questions
    13·1 answer
  • Based on your knowledge of flood-prone areas, where would similar technology be useful in the United States?
    6·1 answer
  • Which statements describe long-term environmental changes
    5·1 answer
  • Digestion of food exothermic or endothermic
    14·1 answer
  • The Venn diagram compares aerobic respiration and anaerobic respiration, Which statement could be categorized in the overlapping
    14·1 answer
  • Electrophysiological studies of rats learning T-mazes have found _________.a. different patterns of activation in the basal gang
    10·1 answer
  • What animal barks like a dog but flys like a Eagle and looks like a rat
    9·2 answers
  • Which statement describes an advantage of sexual reproduction?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!