1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
10

What do you think has been the

Biology
1 answer:
Zepler [3.9K]3 years ago
6 0

Answer:

kjkhjhjhhhj

Explanation:

You might be interested in
Please help ASAP please
Varvara68 [4.7K]
Landslides and Tsunamis
8 0
3 years ago
Read 2 more answers
What happens to the carbon atom during photosynthesis
Genrish500 [490]
After the NADPH molecules are formed, they bring pairs of the the molecules into the next part of photosynthesis. ... During this reaction, both the ATP and NADPH transform the carbon dioxide into carbohydrates. The carbon dioxide molecules come from the atmosphere and then enter the Calvin cycle
8 0
3 years ago
Read 2 more answers
What is the original source of almost all energy in most ecosystems
Serga [27]

Answer:

<em>The sun or solar energy is at the start of almost every energy </em>

<em> chain.</em>

Explanation:

4 0
3 years ago
QUESTION 9
zhannawk [14.2K]
A quadrant streak is the answer
8 0
3 years ago
Write a sentence that compares the reactants and products of photosynthesis with the reactants and products of respiration.
Anna11 [10]

Answer/Explanation:

Using solar energy, photosynthesis uses carbon dioxide and water to produce glucose and oxygen, whereas respiration uses glucose and oxygen to produce energy, releasing carbon dioxide and water.

Therefore, photosynthesis and respiration act as a cycle, using reverse reactants and products.

Photosynthesis builds food for the cell to use, respiration uses this food to power cellular processes.

5 0
2 years ago
Other questions:
  • If black and white true-breeding mice are mated and the result is all gray offspring, what inheritance pattern would this be ind
    15·1 answer
  • Select all the correct answers.
    8·2 answers
  • Where is the epicenter of this earthquake?
    5·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Basis on the fluid mosaic model of the cell membrane, which type of molecule can move passively across the membrane, without the
    13·1 answer
  • Which statement correctly describes the sequence of bases found in a DNA molecule?
    8·2 answers
  • Which is the most likely reason why a person gets cramps during exercising? Why did you choose the answer you did? what happens
    13·2 answers
  • Which of the following statements about planetary satellites is true?
    9·1 answer
  • Marine dinoflagellates and seaweed are members of the ___________ kingdom.
    14·2 answers
  • Most crabgrass preventers are applied is early spring.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!