1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oee [108]
3 years ago
13

What is the major advantage of sexual reproduction over asexual reproduction?

Biology
1 answer:
jarptica [38.1K]3 years ago
3 0
Asexual reproduction produces genetically similar or same offspring whereas sexual reproduction [produces genetically varied offspring.
You might be interested in
Attached earlobes are recessive to free earlobes. What genotypic ratio is expected when an individual with attached earlobes mat
arlik [135]
50/50 shot of recessive or dominate phenotype
7 0
3 years ago
What are stem cells?
Hunter-Best [27]

Answer:

Explanation:

Stem cells are cells with the potential to develop into many different types of cells in the body. They serve as a repair system for the body.

4 0
3 years ago
Read 2 more answers
A hygrometer measures
mash [69]
It is used in measuring the humidity in the air or in gas
7 0
4 years ago
Match each blood vessel with a fact.
Nookie1986 [14]
A. Veins 
B. <span>Arteries
C. </span><span>Capillaries</span>
4 0
3 years ago
Plasmodial slime mold is an example of a multinucleated cell. It can be referred to as “one huge cytoplasmic mass with many nucl
fredd [130]

The cell contains many nuclei containing DNA, so DNA synthesis and mitosis are taking place, but the cell is not undergoing cytokinesis.



5 0
3 years ago
Other questions:
  • During respiration, members of the animal kingdom use ______ and then release ______ as a waste gas. A) oxygen:hydrogen B) carbo
    15·2 answers
  • A mistake by cellular machinery, or damage from an environmental agent such as radiation may produce a(n) ____, which is a perma
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Before there was any life on earth, which gas was absent from earth’s ancient atmosphere? A. nitrogen B. ammonia C. oxygen D. me
    8·1 answer
  • In the body, the major storage sites for glycogen are the muscles and
    5·1 answer
  • Whch lists correctly orders the outer planets from least to greatest from the sun
    5·1 answer
  • Giving everything!!!!!!!!! Plzzzz help!!!!!!!!!!! ASAP!!
    10·1 answer
  • Consider the parts of a polar ecosystem and a desert ecosystem.
    10·2 answers
  • What is a climatic table?​
    15·1 answer
  • What type of immunity exists when a person is exposed to an antigen and subsequently makes antibodies against the antigen?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!