1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alona [7]
3 years ago
14

Explain why a cell needs to replicate its DNA before the cell divides into two daughter cells

Biology
1 answer:
Roman55 [17]3 years ago
7 0
The cell needs to replicate its DNA before mitosis occurs because DNA replication ensures that each daughter cell will have the genetic information it will need to carry out its activities. The process is extremely important to make sure that each daughter cell receives a complete set of genetic information!
You might be interested in
QUIZLET a 48-year old post-menopausal woman complains of irregular bleeding. During the last 6 months she has bled 2- times each
irga5000 [103]

Answer:

Ultrasound scan to rule out polyps or endometrial hyperplasia of the uterus

Explanation:

3 0
3 years ago
Which statement best describes a keystone species
professor190 [17]

The answer is D

One way to remember this is when you are building a bridge there is one piece right in the middle that keeps the whole thing from collapsing that is called the key-stone. If a keystone species goes extinct then the rest of the ecosystem will crumble around it.

5 0
3 years ago
Read 2 more answers
5. Why do scientists publish the results of their work?
Bogdan [553]

Answer:

To verify their results

Explanation:

if they didn't then people wouldn't believe them and they would have no reason to

4 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
This is the question I need help with.
mario62 [17]

Answer:

D

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • For the given quadratic equation convert into vertex form, find the vertex, and find the value for x=6. Show your work.
    8·1 answer
  • With a patient that is administered an injection of erythropoietin (epo) you would expect to see ________.
    8·1 answer
  • BRAINLIESTTT ASAP!
    11·1 answer
  • List 3 organelles that are found in plant cells that are not found in animal cells
    14·1 answer
  • using the food web, describe two complete food chains that include a ptoducer, consumer, and descomposer.​
    10·2 answers
  • Which row (a,b,c or d) in the table accurately categorizes the plant as gymnosperms and angiosperms
    15·2 answers
  • Fertilization occurs when _____.
    11·2 answers
  • During which phase of the cell cycle do sister chromatids first appear?
    12·2 answers
  • PLEASE HELP QUICKLYYYYYY
    11·1 answer
  • Both transcription and DNA replication produce nucleic acids which are polymers of
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!