1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexira [117]
2 years ago
15

Red-flowering snapdragons are homozygous for allele R1. White-flowering snapdragons are homozygous for allele R2. Heterozygous p

lants (R1R2) bear pink flowers. What phenotypes should appear among F1 offspring of the crosses listed below? What are the expected probabilities for each phenotype?
Biology
1 answer:
lana [24]2 years ago
8 0

Answer:

a) 1/2 red, 1/2 pink; b) all pink; c) 1/4 red, 1/2 pink, 1/4 white; d) 1/2 white, 1/2 pink

Explanation:

The flower color trait in snapdragons shows incomplete dominance: the heterozygous genotype produces an intermediate phenotype between the two different homozygous genoytpes.

<u>The possible genotypes and phenotypes are:</u>

  • R1R1 : red
  • R1R2: pink
  • R2R2: white

<h3>a. R1R1 X R1R2 </h3>

The R1R1 individual only produces R1 gametes. The R1R2 parent produces 1/2 R1 gametes and 1/2 R2 gametes.

<u>For that reason, the F1 will be:</u>

  • 1/2 R1R1 (red)
  • 1/2 R1R2 (pink)

<h3>b. R1R1 X R2R2 </h3>

The R1R1 individual only produces R1 gametes. The R2R2 parent only produces R2 gametes.

<u>For that reason, the F1 will be</u> :

  • 100% R1R2 (pink)

<h3>c. R1R2 X R1R2 </h3>

Both parents are heterozygous. This is a monohybrid cross, and from Mendel's Laws <u>we expect the following offspring:</u>

  • 1/4 R1R1 (red)
  • 2/4 R1R2 (pink)
  • 1/4 R2R2 (white)
<h3 /><h3>d. R1R2 X R2R2</h3>

The R1R2 parent produces 1/2 R1 gametes and 1/2 R2 gametes. The R2R2 individual only produces R2 gametes.

<u>For that reason, the F1 will be:</u>

  • 1/2 R2R2 (white)
  • 1/2 R1R2 (pink)
You might be interested in
According to the phylogeny tree, which two phyla are most closely related?
bonufazy [111]
The answer I came up with is Echinoderms and Chordates.

Happy studying!
8 0
3 years ago
Read 2 more answers
When 15n-labeled aspartate is fed to animals, the 15n-label rapidly appears in many amino acids. What reactions are occurring to
malfutka [58]

Aspartate + a- keto acid >> Oxaloacetate + a amino acid

This reaction is occur because the a- keto acid in the equation can come from any amino acid, the 15 N from aspartate is rapidly transferred to other amino acids.

15N is symbol use as the isotope of nitrogen with mass number 15. comprises of 0.4 % of stable nitrogen found, so the relative abundance of each in amino acid is simply a reflection of how much is found in nature in general.

This isotopes is enrichment of the labelled amino acids was determined following a previously developed procedure comprising by determination of the spectral purity of the selected natural abundance amino acids.

To learn more about aspartate here

brainly.com/question/25735714

#SPJ4

4 0
1 year ago
The model shows part of a process that uses tRNA. Which description explains the role of the tRNA in the
ladessa [460]

Answer:

a. The model delivers amino acids to the ribosome so they can

be added to the developing pepetide.

Explanation: tRNA is transfer ribonucleic acid. Its help to aid translation process. They have the appropriate anti codon that is a complement of mRNA i.e messanger RNA they Therefore give the appropriate amino acids to ribosome to form the appropriate polpeptide chain. Each amino acid has its own tRNA.

6 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
¿El olor, la textura, el sabor, el tamaño de un objeto son materiales?
Mrac [35]

Answer:

no

Explanation:

8 0
2 years ago
Other questions:
  • What field of science investigates ideas about a possible extraterrestrial origin of life?
    5·1 answer
  • For a species with a diploid number of 14, indicate how many chromosomes will be present in the somatic nuclei of individuals th
    12·1 answer
  • What kind of rays are produced when a metal, such as tungsten, is bombarded with
    10·1 answer
  • Structure in the living world is organized into hierarchical levels. Which of the following correctly lists these from least inc
    11·1 answer
  • Radioactive amino acids incorporated into the proteins were rejected into the retina of a rabbit. After measuring the radioactiv
    15·1 answer
  • Answer these 4 task cards Plz
    8·1 answer
  • Question 3 of 10
    10·1 answer
  • How can fracking impact water quality? (1 point)
    5·1 answer
  • A student observes that a plant has droopy leaves and stems and infers that the rate of photosynthesis has slowed in the plant.
    13·1 answer
  • Abnormalities in shellfish are common. In one type of abnormality, the DNA of the shellfish contains an extra nitrogen base pair
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!