1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delvig [45]
2 years ago
12

How is the environment organized?

Biology
2 answers:
trasher [3.6K]2 years ago
8 0
The levels of an environment to be organized are populations,species,community,and the ecosystem
prisoha [69]2 years ago
7 0
Well, 
Organism,
Environment,

Both rely on EACH OTHER. Organism, such as animals, humans, etc.

And environment, such as trees, wildlife (not organismic) 
You might be interested in
Hibernation and having heavy fur coats are adaptations of animals in which biome.
Fittoniya [83]

Answer:

A:taiga

Explanation:

Hopefully this helps!

8 0
2 years ago
Read 2 more answers
Tell me a little about prokaryotes and eukaryotes. What do these types of cells have in common? How are they different?
beks73 [17]

Hi There!

Tell me a little about prokaryotic and eukaryotes.

What do these types of cells have in common?

How are they different?

2 very common similarities between the types of cells is that they both have a certain type of structure and all cells have a plasma membrane, DNA, ribosome, etc. They are different in a way that eukaryotes have a "membrane-bound organelle" which usualy includes it having a nucleus. Whats cool is that eukaryotes can be multicellular or singled celled> For Example, plants, insects, and fungi. Prokaryotes don't have a nucleus or organelle (membrane bound).

Hope This Helps :)

4 0
2 years ago
Read 2 more answers
A jogger in July produces large amounts of sweat. Due to this the kidneys change the rate of urine production. Why is this impor
ivolga24 [154]
When it's hot or when the organism starts sweating a lot, this causes an amount of water to be lost from the body. Water is important for the organism to survive and it's absence wi lead to death, therefore Osmoreceptors cells in the hypothalamus in the brain, sends signals to increase the rate of water re-absorption by the kidney. This causes the urine to be of a low volume and more concentrated. This allows enough water to be used by the body as a lot has been lost during sweating.
7 0
2 years ago
What is the name of the cells that control the opening and closing of the stomota
Butoxors [25]

Answer:

guard cells

Explanation:

they control the opening and closing of the stomata

4 0
2 years ago
Illustrate the different stages of Menstrual Cycle.​
Thepotemich [5.8K]

The four phases of the menstrual cycle are menstruation, the follicular phase, ovulation, and the luteal phase. Common menstrual problems include heavy or painful periods and premenstrual syndrome (PMS). Knowing when in the menstrual cycle a woman is most likely to conceive can increase the chance of pregnancy.

6 0
2 years ago
Other questions:
  • Most fungi carry on external digestion.<br><br> True<br> False
    11·2 answers
  • What is Chromatid?<br> what is genome?
    5·2 answers
  • Which gas found in the Earth's atmosphere greatly impacts the daily range of temperature on Earth. A) oxygen B) hydrogen C) nitr
    15·1 answer
  • what is the fluid in the space between the meninges that acts as a shock absorber to the brain and spinal cord called ?
    10·1 answer
  • In the marine food web, which organism are considered predators to more than one organism?
    12·2 answers
  • Which of these is a protein?<br> a) table sugar<br> b) sunflower oil<br> c) collagen
    11·2 answers
  • How could you model this process in a different way? Explain how you’d design this model so that the entire process is clear to
    12·1 answer
  • Explain why the symptoms of celiac disease are consistent with the effects of celiac disease on the small intestine.
    6·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following is true of genetic drift?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!