2 years ago

A sample of wood contains 12.5% of its original carbon-14 what is the estimated age of this sample

1 answer:

6 0

The age of the wood would be 17,151 year's old.

Thank you for posting your question here on brainly feel free to ask as many as needed!! GOOD LUCK! I hope I helped.

You might be interested in

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

2 years ago

After centuries of moderate weather, temperatures are increasing so much that forest fires are rampant.

nikdorinn [45]

climate change is the answer!

6 0

2 years ago

Read 2 more answers

Blank are chemical messagners secreted by glands

elixir [45]

Answer:

The answer is probably hormone

Explanation:

5 0

3 years ago

Label A- Chloroplast<br> Label B- Vacuole

rodikova [14]

What’s the question?

7 0

2 years ago

Read 2 more answers

Which of these vaccines must replicate to stimulate an immune response?

Ket [755]

In order to produce an effective immune response within the body, the person must be injected with a dosage of a virus or bacteria, and for it to be allowed to grow in the person, which replicates just enough to stimulate a response from the immune system.

3 0

2 years ago