1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
7

Earth's magnetic field is created by the (2 points)

Biology
1 answer:
Svet_ta [14]3 years ago
3 0
Your answer is gravitational forces
You might be interested in
Brainliest for correct answer thanks
babunello [35]

THE DEFINITION OF BIODIVERSITY:Biodiversity, also called biological diversity, the variety of life found in a place on Earth or, often, the total variety of life on Earth. A common measure of this variety, called species richness, is the count of species in an area.


BEST ANSWER: Based of the def, I would go with answer A as it makes the most sense.

5 0
3 years ago
How do chemosynthetic organisms get energy? Some examples of organisms include colorless sulfur bacteria, iron bacteria, and gia
Yuliya22 [10]

Answer:

The source of energy for chemosynthesis is energy liberated from a chemical reaction (the oxidation of an inorganic substance)

Explanation:

https://sciencing.com/source-energy-chemosynthesis-6681808.html

4 0
2 years ago
When an economy is experiencing higher real interest rates, business firms will most likely be discouraged from investing in:
denis-greek [22]

Answer: specialized service

Explanation:

An economy experiencing high interest rates will have to reduce investment generally, BECAUSE higher rates increase the BORROWING and demands that ONLY investments with prospect of HIGHER RETURNS (i.e PROFITABLE) should be considered.

Thus, all options are profitable EXCEPT specialized services, as they would be considered a luxury (too costly)

7 0
3 years ago
Which statement is the most accurate prediction of what would happen it a new
andreyandreev [35.5K]

Answer:

A moray eel eats a fish swimming by. Predators are organisms that eat other organisms. If this helps, thank me. If this really helps, thank me and, crown me brainliest answer. Also, rate, and comment. This helps me to improve answering, and helps you to get a better answer.

Explanation:

7 0
3 years ago
Read 2 more answers
Question 10 (2 points)
Keith_Richards [23]

Answer:

mass

Explanation:

because the unit kg is S.I unit of mass

5 0
3 years ago
Other questions:
  • Which vitamin helps vision and the development of body cells
    10·2 answers
  • What is the medical term for swelling with mucus under the skin? lom?
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why are glass cylinders preferred over plastic cylinders for conducting lab experiments?
    7·1 answer
  • What is the difference between a light microscope and an electric microscope?
    10·1 answer
  • HELP !!
    14·2 answers
  • Does anyone else have this assignment from ReadWorks?
    14·1 answer
  • Is sample M most likely to be chicken, rice, a mango, or butter?
    8·1 answer
  • How does runoff affect aquifers? ​
    8·1 answer
  • If you answer under 30 minutes, I will give Brainiest!!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!