1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kitty [74]
3 years ago
11

What combination of boundary type and crust type creates enormous mountains?

Biology
1 answer:
Sergio039 [100]3 years ago
6 0

both of them I guess...

You might be interested in
Protists are helpful to us because they
Sergio [31]

Answer:

Protists help break down dead material and help produce oxygen

Explanation:

I just took the quiz on k12

4 0
2 years ago
Name the enzyme that breaks down H2O2.. Anybody know?!?!?!?!
Alborosie
The enzyme that breaks down H2O2 is called catalase.
3 0
3 years ago
Why is it necessary for green plants to carry out both photosynthesis and respiration?
finlep [7]
To survive and to reproduce
6 0
3 years ago
Read 2 more answers
9. Which structure helps animal cells maintain their shape?
ludmilkaskok [199]

Answer:

<em><u>D. Cytoskeleton</u></em>

Explanation:

It is really none of these answers. The correct answer would be a microtubule which is a component of the cytoskeleton which is in the cytoplasm.

The Cell Walls are only in plant cells so that won't work.  So, A wouldn't work.

Chromosomes are the things that both your parents give you as genes. They have nothing to do with keeping the structure of the cell alright.

Cytoplasm cannot be a answer choice because, the thing is in it but, it doesn't do anything with it. So C wouldn't work either

The correct answer is microtubule however, it is a component of cytoskeleton so therefore, that is your answer.

<em><u>Reference the picture below:</u></em>

4 0
3 years ago
Why are G protein only found in Eukaryote cell ?
Levart [38]

Answer:

they bind to protein-coupled transmembrane receptors with higher complexity than those found in prokaryotes

Explanation:

G-proteins are proteins found inside the cells that function as molecular switches which are activated by binding to guanosine triphosphate (GTP), while they are inactive by binding to guanosine diphosphate (GDP). The G-proteins bind to G-protein-coupled transmembrane receptors (GPCRs) in the cytoplasmic region. The GPCRs are a very diverse group of proteins that are activated by extracellular molecules ranging from small peptides to large proteins, including pheromones, neurotransmitters, light-sensitive compounds, etc, thereby allowing them to respond to diverse stimuli from the extracellular environment. In consequence, it is reasonable to suppose that the signaling pathways in which G proteins are involved have a higher complexity level than those observed in primitive prokaryotic organisms.

6 0
3 years ago
Other questions:
  • In which changes of state do atoms lose energy?
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The study of genetics and inheritance begins with a look inside the nucleus of a cell true or false
    11·1 answer
  • Osteoporosis is more prevalent among women than men because women generally
    9·2 answers
  • What is the density of a football
    6·2 answers
  • Normalization refers to providing opportunities for individuals with disabilities to go to school and participate in education e
    13·1 answer
  • Which is most likely not a beneficial contribution made by biologists?
    8·1 answer
  • So whats the answer?
    14·1 answer
  • 15 POINTS!!
    10·1 answer
  • What are the two major methods by which cells communicate to coordinate their functions?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!