1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
3 years ago
12

Which two main processes take place to produce proteins -A differentiation and specialization B- mitosis and meiosis C-photosynt

hesis and cellular respiration D-transcription and translation

Biology
2 answers:
ELEN [110]3 years ago
7 0
D- transcription and translation
tresset_1 [31]3 years ago
7 0

Answer:

D-transcription and translation

Explanation:

The main processes for protein production are transcription and translation.

Basically, the steps of protein synthesis comprise DNA "transcribed" by messenger RNA (mRNA). Subsequently, the transcribed information will be translated by ribosomes and carrier RNA (tRNA), which, as its name suggests, will carry amino acids, the sequence of which will determine protein formation.

Proteins are abundant organic compounds found in all organisms. According to some authors, in superior animals, these macromolecules constitute approximately 50% of the dry weight of their tissues. Proteins are present in virtually all cellular structures, and are still responsible for the constitution of antibodies and hormones, for example.

You might be interested in
Which process removes carbon from the atmosphere and then it into glucose using the energy from sun
Viktor [21]

Answer:

Explanation:

Wild guess. Photosynthesis

3 0
3 years ago
Describe the Ribosome function organelle
Alenkinab [10]
Protein synthesis as well as DNA transcription
4 0
3 years ago
The pupil is the adjustable opening in the center of the eye through which light enters. transparent structure that focuses ligh
Black_prince [1.1K]

Answer:

1) IRIS

2) LENS

3) RETINA

4) Fovea Centralis

Note: Answers 1 - 4 follows question pattern

Explanation:

The PUPIL is the hole in the MIDDLE of the IRIS of the eye, through which light passes to be focused on the RETINA.

The IRIS is the contractile membrane perforated by the pupil, which adjusts to control the amount of light reaching the retina, and which forms the colored portion of the eye

ACCOMMODATION is the change in the adjustment of the eye lens to help focus light ray.

RETINA helps to receive light rays that the lens has focused. It contains two cells: rods and cones

Fovea Centralis is at the center of the retina responsible for sharp and accurate vision, also it is where cones cells cluster.

7 0
4 years ago
3) Look carefully at the following structural formula, and predict if this compound would turn black if heated
olga nikolaevna [1]

Answer:

It would turn black. H H 6. It would not turn black. does Briefly explain why you chose either a or b. Because it does not contain courbon or any such compound which change color upon heating

7 0
2 years ago
Explain how the population of rock pocket mice changed fur color over time.
Lorico [155]

Answer:

Most genes are identical, but dark and light rock pocket mice differ in one gene (Mc1r; 4:55). Data from Data Set 2 show that a mouse's genotype for the MC1R gene affects their fur color. Mice with two copies of allele 2 have the darkest fur.

Explanation:

thank me later

8 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Describe the structure and function of fatty acid molecules, including the difference between saturated and unsaturated fatty ac
    14·1 answer
  • How was the earth created and humans????
    9·2 answers
  • How many variables should you have in a control experiment?
    15·2 answers
  • In order to perform, a chemist needs an element that has similar properties to potassium (K) but has a lower atomic mass. which
    5·2 answers
  • Glycolysis is the name given to a metabolic pathway occurring in many different cell types. It consists of 11 enzymatic steps th
    10·1 answer
  • HELP PLEASE
    6·1 answer
  • PLZ HELP!!!!! I WILL GIVE BRAINLIEST!!!!!!!!!!!
    10·2 answers
  • Helpppppp!!!!<br><br> Which feature is an example of psychological adaptation?
    13·1 answer
  • What is the effect of an increased concentration of calcium ion in the sarcoplasm?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!