Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
processing information that is received from the stimuli receptors
sending out information so that the body can react appropriately to stimuli
coordinating reflexes and reactions to stimuli
The right answer is The cells are damaged.
Take the example of skin cells.
The skin consists of two tissues:
* the outermost, the epidermis, resting on a vascularized connective tissue,
* the dermis.
In the epidermis, which includes several layers of cells, the outer layer is formed of dead cells that are desquamating and are constantly being replaced from proliferating basal cell cells. So, in normal conditions, the epidermis is in constant renewal.
On the other hand, when accidentally, the upper parts of the epidermis are damaged, for example, a slight abrasion or of a burn, the destroyed portion is regenerated (replaced) thanks to an accelerated proliferation of basal epidermal cells .
You absorb vitamin d from sunlight shining on your skin.
Vitamin d can help the absorption of calcium, which is capable for strengthening your bones and teeth.
Therefore if u r lacking of vitamin d, your bones and teeth may be soft, and especially among children, you may get ricket, where the legs are bent outwards.
