1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
romanna [79]
3 years ago
10

WILL GIVE BRAINLEST

Biology
1 answer:
Tems11 [23]3 years ago
7 0

Answer:

Cl-

Ca2+

Explanation:

An ion is a charged atom or group of atoms. An ion may be formed from an atom or from a molecule.

When an ion is formed from an atom, the atom now has either an excess or an insufficient number of electrons. This will lead to the development of a negative or positive charge in the atom as the case may be.

Cl- and Ca2+ are two ions formed from atoms, the first one has an excess of one electron while the other have lost two electrons

You might be interested in
Describe each type of mountain. Include the type of boundary where they are likely formed and characteristics of each. Folded Mo
irina1246 [14]

Answer:

Folded mountains are all those originated by movements and collisions of the great plates that form the earth's crust. Fault-block mountains are those that appear from a break in the crust, a fact that causes the rock blocks to move up and down and form elevations.

Explanation:

The parallel movement of the earth's crust leads to the appearance of Folded Mountains. According to this theory, Folded Mountains originate from the collision between two tectonic plates. Some of these plates are huge and can support and carry entire continents. When two plates collide, the denser one gets under the other, and this causes the sediments deposited in the basin or geosyncline that separated them to fold up. The large folds formed in the compressed sediment can break apart and form mountains.  Fault-block Mountains are related to normal wide-angle faults that gradually decrease in dip with depth. Most of the Fault-block Mountains form in response to a large uplift.

8 0
3 years ago
What is Xerophiles scientific name?
Gelneren [198K]

Answer:

hope you like it

Explanation:

A xerophile (from Greek, Modern xēros, meaning 'dry', and philos, meaning 'loving'. It is a plant that thrives in dry environment such as desert. It is an organism that can grow and reproduce in conditions with a low availability of water,

Examples of xerophiles include Trichosporonoides nigrescens and cacti. There are many types of cacti. Trichosporonoides nigrescens is the scientific name of one of them.

8 0
3 years ago
Identify the four postulates of natural selection. select all that apply. view available hint(s) select all that apply. individu
scoundrel [369]
Natural selection is one of the basic mechanisms of evolution during which those variations in the genotype that increase organism's chances of survival and procreation are preserved and multiplied from generation to generation at the expense of those that are less advantageous. In this case the following are postulates of natural selection; Individuals with certain traits are more likely to survive and reproduce, individuals in a population vary more likely to survive and reproduce, survival and reproductive success are variable among individuals in a population and lastly some traits differences are heritable.
7 0
3 years ago
The origin of a muscle is generally
levacccp [35]

explain the  question more

4 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Many serious diseases can be passed from parent to offspring through genes. In which case given below is a recessive disease NOT
    9·1 answer
  • This organelle most likely belongs to which organism?
    9·2 answers
  • Many cows are given antibiotics as part of their regular diet. It has been determined that these antibiotics can be detected in
    11·1 answer
  • The history of primate evolution is filled with the evolution of new species but also countless extinctions. While factors in ea
    9·1 answer
  • An advantage of gas exchange in fresh water, compared with gas exchange in air, is that:
    12·1 answer
  • Compared to the Linnaean system of classification, what is the advantage of classifying species into clades? A. Clades show evol
    9·1 answer
  • Are the cell in this image prokaryotic or eukaryotic?
    5·2 answers
  • Opposite charges (-, +) ____________and like charges (+, +) ___________.
    8·2 answers
  • The table above lists the types of white blood cells found in humans, indicates how abundant they
    12·1 answer
  • The synthetic equivalent of corticosteroids produced by the body is called
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!