1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
3 years ago
9

Why is the theory of evolution important?

Biology
2 answers:
Cerrena [4.2K]3 years ago
6 0
The answer is B, it provides a topic for debate.
kari74 [83]3 years ago
3 0

Answer:

B. it provides a topic for debate

Explanation:

its not A because its described as a theory not a universally excepted law. Its not C or D for the same reason. B isn't that good of an answer i wish it was worded differently but its the one that makes the most sense.

You might be interested in
Which of the following statements is true about the scientific process?
sleet_krkn [62]
"The hypothesis is always supported in the end" is the one statement among the following that <span>is true about the scientific process. The correct option among all the options that are given in the question is the first option. I hope that this is the answer that has actually come to your help.</span>
3 0
3 years ago
How are electromagnetic waves including light waves,classified?
Delvig [45]

Answer:

Electromagnetic waves can be classified and arranged according to their various wavelengths/frequencies; this classification is known as the electromagnetic spectrum. ... These types of energy include infrared (IR) rays (heat waves given off by thermal bodies), microwaves, and radio waves

Explanation:

6 0
3 years ago
What kind of atom tends to lose one electron?
Romashka-Z-Leto [24]

Answer:

Metals

Elements that readily lose electrons are all metals. Metals that normally lose one electron all form +1 ions with electron configurations we call “stable,” or “energetically favorable.” Element that are metal tend to loss electrons and became positively charged Ion called cations.

Explanation:

Your letter answer: C

4 0
4 years ago
Read 2 more answers
When sea ice melts, there will be a significant amount of sea level rise.<br> O True<br> O False
Andru [333]

It will be true, since the ice bergas that fall off can be as big as a 98-164 feet. Form what I have resched

3 0
3 years ago
Read 2 more answers
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
Other questions:
  • Getting enough vitamin d may be a problem for older adults due to
    12·1 answer
  • What are t-cells? What role do they play?
    11·1 answer
  • How are bacteria evolving to become more dangerous and virulent towards humans?
    6·1 answer
  • Why do embryologist study embryos?
    13·1 answer
  • What is the purpose of having leak and gated channels for the neuron?
    5·1 answer
  • Explain how the disruption can disturb the cycling of carbon ?
    13·1 answer
  • What is the first part of the plant to emerge?
    14·2 answers
  • 2 points
    8·1 answer
  • When does osteogenesis begin?
    7·1 answer
  • I need help please ?!!!! Asap thank you (:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!