1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
3 years ago
7

How do you think this food web would be affected if the plants were eliminated?

Biology
2 answers:
Ganezh [65]3 years ago
3 0
The food web would completely collapse because plants are main resource for obtaining ur energy
castortr0y [4]3 years ago
3 0
C)
The food web would completely collapse.
You might be interested in
Which of the following is NOT true about the FemCap cervical cap?
Kazeer [188]

Answer:

Explanation:

it must be kept in place at least 10 hours after intercourse

5 0
3 years ago
What is not an example of energy in the transformations in an ecosystem
Yakvenalex [24]
What are my choices?
8 0
3 years ago
Mutations are important for evolution because they
Vikki [24]
Mutation causes change in an organisms DNA, resulting in a change in all aspects of the organisms life. It affects how the organism looks, and how it behaves. If there was no mutation, an organism could not change, therefore there wouldn't be evolution at all.
5 0
3 years ago
Read 2 more answers
The relationship between humans and their digestive bacteria can be described as... A) Commensalism B) Competition C) Mutualism
Flura [38]

Answer: The correct answer is -

C) Mutualism.

Explanation:

Mutualism is a type long term biological relationship between two organisms belonging to same or different species in which both are benefitted from one another.

For example - E.coli bacteria, present large intestines of human, gets food and place to live in our digestive tract. In return, the bacteria produce vitamin K, which make it harder for other disease causing bacteria to establish in our system.

Thus, option C) is the right answer.

7 0
3 years ago
Read 2 more answers
Which feature distinguishes slime molds from fungi?
katrin2010 [14]

Answer:

3. Slime molds are able to move (However,Fungi can't move around so they make spores that are like seeds)

3 0
3 years ago
Other questions:
  • In animals, embryonic stem cells differ from adult stem cells in that
    15·1 answer
  • What is an organism's habitat? what is its niche? how do these differ?
    7·1 answer
  • If you take into account the amount of ATP generated by ATP synthase per molecule of NADH produced in aerobic respiration, the n
    9·1 answer
  • Select the correct answer.
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • _____ foods are sources of fat-soluble vitamins. _____ foods are sources of fat-soluble vitamins. Less-cooked nonfatty fat-conta
    8·1 answer
  • Using the help of the semi conservative replication of DNA, What is the role of a single strand of DNA ?
    8·1 answer
  • Which characteristics is common of developing countries?
    15·1 answer
  • If a robin builds a nest in a big tree, the robin benefits and the tree is not helped or harmed. This type of symbiotic relation
    14·1 answer
  • What did James Watson and Francis crick discovered
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!