1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pani-rosa [81]
3 years ago
15

Which biome has the highest diversity of species?

Biology
2 answers:
Anika [276]3 years ago
8 0
C). Tropical rain forest
Inga [223]3 years ago
4 0

Answer:

C. Tropical rain forest is a correct answer

Explanation:

Tropical rain forest biome has the highest diversity of species.

The tropical rain forest has the following characteristics,which make them have the highest diversity of species

  • it is the oldest biome, they have more time to diversify and ecological obstacles are less.
  • Tropical rain forest each year they receive heavy rainfall, and the climate of the tropical region is favorable for the existence of a large number of species.
  • As the tropical rain forest is located in the tropical region, they get sufficient sunlight and it is converted into energy by plants by the method of photosynthesis, this result in the availability of lots of energy in the tropical rain forest which supports an abundance of animal and plant species.

Thus this is the reason Tropical rain forest biome has the highest diversity of species.

You might be interested in
Which of the following environmental changes is most difficult to survive?
BlackZzzverrR [31]

Answer:

I'm thinking the answer would be C if not then it would be B

Explanation:

7 0
3 years ago
​an associated characteristic linked to anorexia nervosa is ____.
mr_godi [17]
An associated characteristic linked to anorexia nervosa is purging after food consumption where an individual forces out the food that he or she consumed

3 0
3 years ago
Fossilized non-seed vascular plants from the ____________________ Period have been identified. a. Devonian c. Permian b. Cambria
Ipatiy [6.2K]
Fossilized non-seed vascular plants from the Devonian period have been identified. 
<span>The Devonian is an early period and conformity of the Paleozoic Epoch forming from the edge of the Silurian Era.</span>
6 0
3 years ago
List five properties that are used most commonly to identify minerals.
melamori03 [73]
 hardness<span>, </span>luster<span>, </span>color<span>, </span>streak<span>, </span>specific gravity<span>, </span>cleavage<span>, fracture, and </span>tenacity<span>.</span>
8 0
3 years ago
Will give brainliest:
yaroslaw [1]
The answer A. DNA in the nucleus controls all cell activity.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Ow does water enter the atmosphere?
    13·1 answer
  • A large population of laboratory animals has been allowed to breed randomly for a number of generations. after several generatio
    8·1 answer
  • When culturing a chemoorganoheterophic bacterium, what outcome is LEAST likely to occur if ammonia and phosphate are provided at
    8·1 answer
  • When the comb jelly, Mnemiopsis leidyi, was introduced into the Black Sea, its population exploded to 500 comb jellies per cubic
    15·1 answer
  • 2.
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Bradley is watching his twin daughters play on a playground seesaw, and is fascinated by the way only one side can be up or down
    5·1 answer
  • If your name were a scientific name, which part would be the species?
    15·2 answers
  • If an Hh (unhealthy) female and Hh (unhealthy) male were to reproduce, what percentage of their children would be affected with
    11·1 answer
  • What is the evolved jellyfish a very highly type of?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!