1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pochemuha
3 years ago
9

Dam naj za poprawną odp

Mathematics
1 answer:
Morgarella [4.7K]3 years ago
3 0
<span>Po pierwsze, należy dodać dwie frakcje razem na szczycie.

3 2/3 + 1 1/3 = 4 3/3 = 5


</span><span>Teraz przychodzi do 5/2
</span>
<span>Lub 2 1/2 jako liczba mieszanej.</span>

Nawiasem mówiąc, użyłem Google Translate
You might be interested in
I need help on this question ​
dlinn [17]

Answer: number 3

Step-by-step explanation:

7 0
3 years ago
On Saturday, 2.4 inches of snow fell. Another 8.125 inches of snow fell on Sunday. What was the total amount of snow that fell i
AfilCa [17]
To get your answer you add the two numbers together. That gets you 10.525 inches of snow.
6 0
3 years ago
Grant decided to buy some cookies from tiff
Alja [10]

Answer:

3+.50d=

Step-by-step explanation:

3 represents $3.00

.50 represents $0.50 for each mile

d represents the total cost

6 0
3 years ago
55+p=105 What is the variable
natta225 [31]
55+p=105
subtract 55 from both sides
p=50
MAGIC
8 0
3 years ago
Read 2 more answers
Solve for x the rest of the question is in the png
zvonat [6]

Answer:

33.18

Step-by-step explanation:

Use law of sines.

x / sin(65°) = 21 / sin(35°)

x = 21 sin(65°) / sin(35°)

x ≈ 33.18

3 0
4 years ago
Other questions:
  • jane paid $40 for an item after she received a 20% discount. janes friend says this means that the original price of the item is
    6·1 answer
  • The median salary for a chiropractor in the United States is $81,500 per year, according to the U.S. Department of Labor. A grou
    6·1 answer
  • What is the result of adding these two equations?<br> 6x+2y=−2<br> 3x−2y=−5<br><br> ​ <br><br> ​
    8·2 answers
  • In the expression 1 o 2 o 3 o 4 each o is to be replaced be either + or x.
    10·1 answer
  • Given the diagram below, Gitta writes that 1 + 2 + 3 = 180. Which of the following reasons allows her to write this statement
    14·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Order from least to greatest 6/7,-1/7 , -6/7 ,0, 5/7
    13·1 answer
  • Can u answer it<br> Is it <br> A<br> B<br> C<br> D <br> Look at the graph
    7·1 answer
  • Write an expression for the sequence of operations described below.
    8·1 answer
  • Using x=7, how can we solve for the angle "9x+61"?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!