1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
navik [9.2K]
3 years ago
5

________ floods are limited in area, occur with little warning, and are most common with intense rainfall events in areas of imp

ervious surface conditions or steep topography.
Biology
1 answer:
sertanlavr [38]3 years ago
7 0
Flash floods are limited in area, occur with little warning, are most common with intense rainfall 
You might be interested in
How are feral cats threatening the existence of nearly 100 species in Australia?
ankoles [38]
Feral cats threaten<span> the survival of over </span>100<span> native </span>species in Australia<span>. They have caused the extinction of some ground-dwelling birds and small to medium-sized mammals. </span>
3 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
The bushes have alleles for blue and red berries. Bushes with both red and blue alleles make purple berries.
Sedbober [7]

Answer:For more plants to have blue berries

Explanation:

3 0
3 years ago
How many body cavity are there in human body?
KiRa [710]
Hello there.

How many body cavity are there in human body?
Four
8 0
3 years ago
When oxygen is available,<br>cellular respiration takes place.​
nexus9112 [7]

Cellular respiration is a process that all living things use to convert glucose into energy. Autotrophs (like plants) produce glucose during photosynthesis. Heterotrophs (like humans) ingest other living things to obtain glucose. While the process can seem complex, this page takes you through the key elements of each part of cellular respiration.

Cellular respiration is a collection of three unique metabolic pathways: glycolysis, the citric acid cycle, and the electron transport chain. Glycolysis is an anaerobic process, while the other two pathways are aerobic. In order to move from glycolysis to the citric acid cycle, pyruvate molecules (the output of glycolysis) must be oxidized in a process called pyruvate oxidation.

Glycolysis

Glycolysis is the first pathway in cellular respiration. This pathway is anaerobic and takes place in the cytoplasm of the cell. This pathway breaks down 1 glucose molecule and produces 2 pyruvate molecules. There are two halves of glycolysis, with five steps in each half. The first half is known as the “energy requiring” steps. This half splits glucose, and uses up 2 ATP. If the concentration of pyruvate kinase is high enough, the second half of glycolysis can proceed. In the second half, the “energy releasing: steps, 4 molecules of ATP and 2 NADH are released. Glycolysis has a net gain of 2 ATP molecules and 2 NADH.

Some cells (e.g., mature mammalian red blood cells) cannot undergo aerobic respiration, so glycolysis is their only source of ATP. However, most cells undergo pyruvate oxidation and continue to the other pathways of cellular respiration.

Pyruvate Oxidation

In eukaryotes, pyruvate oxidation takes place in the mitochondria. Pyruvate oxidation can only happen if oxygen is available. In this process, the pyruvate created by glycolysis is oxidized. In this oxidation process, a carboxyl group is removed from pyruvate, creating acetyl groups, which compound with coenzyme A (CoA) to form acetyl CoA. This process also releases CO2.

Citric Acid Cycle

The citric acid cycle (also known as the Krebs cycle) is the second pathway in cellular respiration, and it also takes place in the mitochondria. The rate of the cycle is controlled by ATP concentration. When there is more ATP available, the rate slows down; when there is less ATP the rate increases. This pathway is a closed loop: the final step produces the compound needed for the first step.

The citric acid cycle is considered an aerobic pathway because the NADH and FADH2 it produces act as temporary electron storage compounds, transferring their electrons to the next pathway (electron transport chain), which uses atmospheric oxygen. Each turn of the citric acid cycle provides a net gain of CO2, 1 GTP or ATP, and 3 NADH and 1 FADH2.

Electron Transport Chain

Most ATP from glucose is generated in the electron transport chain. It is the only part of cellular respiration that directly consumes oxygen; however, in some prokaryotes, this is an anaerobic pathway. In eukaryotes, this pathway takes place in the inner mitochondrial membrane. In prokaryotes it occurs in the plasma membrane.

The electron transport chain is made up of 4 proteins along the membrane and a proton pump. A cofactor shuttles electrons between proteins I–III. If NAD is depleted, skip I: FADH2 starts on II. In chemiosmosis, a proton pump takes hydrogens from inside mitochondria to the outside; this spins the “motor” and the phosphate groups attach to that. The movement changes from ADP to ATP, creating 90% of ATP obtained from aerobic glucose catabolism.

7 0
3 years ago
Other questions:
  • Microbes that thrive in acidic environments seem to have "cost free" ATP energy available to them due to the pre-existing H grad
    15·1 answer
  • How do parasitic flatworms evade their host's immune system?
    5·1 answer
  • What makes metals like copper conductive to electricity
    7·1 answer
  • Rh blood factor is determined by:
    7·1 answer
  • Are enzymes used up after they do their job of helping build a molecule or helping breakdown a molecule...or are they used again
    13·1 answer
  • Which quantity in the equation E = mc2 will most likely be the smallest?
    8·2 answers
  • 1) Label the following terms in the following picture
    15·1 answer
  • · Nitrogen enters the food web when _________ absorb nitrogen compounds from the soil and convert them into ___________.
    5·1 answer
  • Where is the dna stored?
    9·1 answer
  • What is TRUE about the North and South Poles? Select all that apply.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!