Answer:
forgot to add the question
Answer:
Eugleas create their own food through photosnthsis, the process of absorbing sunlight to synthesize foods from carbon dioxide and water. An eyespot at the front end of the euglena detects light I belive
Explanation:
Answer:
students who want to go to Brentview Arts must fill out an online application
Explanation:
if the only way to get into Brentview Arts is by doing an application online, then computers would help those students. They can't send it through the mail so the computer would be their only resource
Answer:
Bose-Einstein condensate (BEC), a state of matter in which separate atoms or subatomic particles, cooled to near absolute zero
(0 K, − 273.15 °C, or − 459.67 °F; K = kelvin), coalesce into a single quantum mechanical entity—that is, one that can be described by a wave function—on a near-microscopic scale.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
