1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
15

Most organisms use DNA as their genetic material. RNA viruses are able to use RNA instead.What molecular mechanisms allow these

viruses to use RNA as their genetic material instead of DNA?
Biology
1 answer:
Lera25 [3.4K]3 years ago
6 0

Answer:

Reverse transcription

Explanation:

Some viruses such as HIV have RNA as genetic material.  In them RNA stores genetic information. These viruses are called retroviruses. They are known as retroviruses because they have the enzyme reverse transcriptase. During protein synthesis, they use RNA as a template to synthesise complimentary DNA with the help of reverse transcriptase. Thus central dogma is as follows:

RNA ⇒ DNA  ⇒   mRNA ⇒ protein  

Reverse transcription ⇒ Transcription ⇒ translation  

You might be interested in
Why might a computer model be used to study the movement of atoms
allsm [11]
Atoms are so small and its easier to controll it that way. hope that helps
8 0
3 years ago
Traits can be from anyone. Like your auntie or uncle even cousin??, also why can your auntie can cause you have cancer??
artcher [175]

Answer:

because

Explanation

oof irdk but it genetics is weird it changes to

6 0
2 years ago
A real case where RFLP was used.
Andru [333]

Answer:

Alec Jeffreys and the Pitchfork murder case: the origins of DNA profiling

British geneticist Alec Jeffreys began working in 1977 on a technique that could identify individuals through samples of their DNA. In 1984, he and colleagues devised a way to use a newly discovered property of DNA, isolated areas of great variability between individuals called restriction fragment length polymorphisms (RFLP), for forensic identification—the original DNA fingerprint.

In 1986, police asked Jeffreys for help in finding a man who had raped and killed two girls. DNA tests exonerated the primary suspect. Through a genetic dragnet, police found the perpetrator, Colin Pitchfork, who gave himself away when he asked a friend for a substitute blood sample.

Within a year, genetic fingerprinting was making the unique molecular structures of victims and suspects visible in criminal investigations around the world. Today, RFLP-based DNA analysis is being supplanted by newer techniques of genetic identification.

Explanation: .

5 0
2 years ago
What would you need to do to make a drum have a louder sound
const2013 [10]
Adjust the drum's tuning, or change the drum head to a different type.
5 0
3 years ago
The competitive exclusion principle states that A) two species cannot coexist in the same habitat. B) competition between two sp
Rzqust [24]

The competitive exclusion principle states that D) two species with the exact same niche cannot coexist in a community.

This is because they would be both fighting for the same resource and therefore one species would starve the other species out or destroy the other species.

6 0
3 years ago
Other questions:
  • How does the recesive sickle-cell allele stay in the gene pool
    11·1 answer
  • Which organelle is most like a factory delivery driver?
    14·2 answers
  • Part A
    13·1 answer
  • Which is a characteristic of exponential population growth?
    15·1 answer
  • Homeostasis will be most affected by the removal of the
    14·1 answer
  • What neurotransmitter systems do methylated amphetamines affect?
    12·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • How can biotic and abiotic factors affect the size of a population? Give an example of a biotic and an abiotic factor that could
    8·2 answers
  • In the image below, what kind of molecules does the label A represent?
    15·2 answers
  • Describe the movement of the dominoes as energy is transferred through them and then compare the movement of longitudinal waves
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!