1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
4 years ago
11

Which of the following organelles is primarily responsible for the formation of the cell's lysosomes

Biology
1 answer:
Marizza181 [45]4 years ago
5 0
<h3><u>Answer;</u></h3>

Golgi apparatus or Golgi complex or Golgi bodies

<h3><u>Explanation;</u></h3>
  • <u><em>Golgi apparatus are also called Golgi bodies or Golgi complex. They are complex vesicles and folded membrane within the cytoplasm of eukaryotic cells.</em></u>
  • <em><u>Golgi apparatus are important in the secretion and intracellular transport roles. A major function is the modifying, sorting and packaging of proteins for secretion. T</u></em><em><u>hey are also involved in the transport of lipids around the cell, and the creation of lysosomes.</u></em>
  • Therefore, <u><em>Golgi apparatus are the organelles responsible for the formation of lysosomes, which are organelles that destroy old and worn out cellular organelles. </em></u>
You might be interested in
What type of RNA is a major component of the structure at which protein synthesis occurs
Zolol [24]
Ribosomal RNA (rRNA)
3 0
4 years ago
Read 2 more answers
When two pea plants with Tt genotypes are cross-bred how many short (tt) plants will there most likely be in the new generation
oksian1 [2.3K]

Answer:

25%

Explanation:

Tt will cross with Tt resulting in 25% TT, 50% Tt, and 25% tt

7 0
3 years ago
Name a structure that is located toward the dorsal side of the body, lateral and superior to the hamstring but inferior to the h
sdas [7]

Answer: Kidney

Explanation:

Kidney is a structure that is located toward the dorsal side of the body, lateral and superior to the hamstring but inferior to the heart.

The kidneys are a pair of bean shaped organs that are located at the downward part of the rib cage. The body of humans consists of two kidneys one kidney on each side of the spine and they're responsible for the filtering of excess water, waste products, and other impurities out of the human body.

8 0
3 years ago
Since passive transport mechanisms do not require ATP, what principle drives their
Romashka [77]
Passive transport is a naturally occurring phenomenon and does not require the cell to expend energy to accomplish the movement. In passive transport, substances move from an area of higher concentration to an area of lower concentration in a process called diffusion.
8 0
3 years ago
Which four molecules are the DNA
poizon [28]
Adenine, thymine, guanine, and cytosine
3 0
4 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A species of aquarium fish displays differences in stripe patterns as shown in the diagram below
    11·2 answers
  • What is the role of sensory neurons in the breakdown of food?
    15·2 answers
  • Where should reactions involving the evolution of toxic gases be performed?
    11·1 answer
  • What is an ethical concern regarding genetic engineering? privacy of genetically tested individuals unnatural and potentially da
    14·1 answer
  • For your physical anthropology research project, you report that you measured the length of 150 gorilla thighbones, and you sugg
    11·1 answer
  • New hair cells divide and grow in the hair:
    12·1 answer
  • Which cranial nerve is responsible for the motor innervation of pharyngeal muscles and parotid salivary glands?
    12·2 answers
  • What does your body do with the heat released during cellular respiration?
    13·1 answer
  • Heparin, a highly negatively charged glycosaminoglycan, is used clinically as an anticoagulant. It acts by binding several plasm
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!