1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anygoal [31]
3 years ago
6

How does a wave affect energy? How does a wave affect matter

Biology
2 answers:
elixir [45]3 years ago
6 0

Answer:sdfghjk

Explanation:

34kurt3 years ago
3 0
A high energy wave is characterized by a high amplitude; a low energy wave is characterized by a low amplitude. ... Putting a lot of energy into a transverse pulse will not effect the wavelength, the frequency or the speed of the pulse.
You might be interested in
Think of two types of biomes and list them.  Describe how they are similar.  What are the differences between the two types of b
Zarrin [17]

Answer:

Dessert and tundra

Explanation:

Theses two biomes get very little rain and because of this they have a less diversity of fauna and flora.

The differences are that a tundra is very dry and extremely cold and on the other hand a desert is very arid and hot and it can go as high as 54°C (130°F).

7 0
3 years ago
In proteins, amino acids are linked by peptide bonds; in polynucleotides, nucleotides are linked by ________.
Sergeeva-Olga [200]

Answer: Phosphodiester bond

Explanation:

The backbone of DNA consists of deoxyribose nucleotides linked by phosphodiester bridges.

The 3'-hydroxyl of the adjacent sugar of one deoxyribonucleotide is joined to the 5'-hydroxyl of the adjacent sugar by an internucleotide linkage called a phosphodiester bond.

Thus, phosphodiester bond is the answer

5 0
3 years ago
Read 2 more answers
Choose the best answer that makes the sentence correct. A membrane that allows only some materials to move in and out of the cel
nasty-shy [4]
A membrane that allows only some materials to move in and out of the cell is B. Semipermeable.
8 0
3 years ago
Read 2 more answers
Gentoo penguins will present a mate with a pebble that they find to attract a mate. Emperor penguins have a specific call and mo
Mrac [35]
<span>B is the right answer. Gentoo and Emperor penguins employing different mating rituals is an example of behavioral isolation. Behavioral isolation is the umbrella term for a host of differences between species, although in the case of different mating behaviors this variety of behavioral isolation is intended to prevent cross-breeding between different members of the same species in the same environment.</span>
7 0
3 years ago
Read 2 more answers
Why was important for Miller and Urey to sterilized the apparatus to kill any bacteria in it?
Elena L [17]

Answer:

The Miller–Urey experiment (or Miller experiment) was a chemical experiment that simulated the conditions thought at the time to be present on the early Earth, and tested the chemical origin of life under those conditions. The experiment supported Alexander Oparin's and J. B. S.

Explanation:

3 0
3 years ago
Other questions:
  • What do an atom of the chlorine and an atom of bromine both have?
    15·1 answer
  • A magnetic field protects Earth from the Sun's high-energy particles. What two processes are involved in the formation of Earth'
    10·2 answers
  • Do dogs have Endocrine Respiratory Circulatory Digestive Skeletal Muscular Nervous ​Urinary systems
    12·1 answer
  • Consider this animal cell.<br> Which organelles are labeled G?
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which statement accurately describes how identification of individuals through the use of genetic engineering is possible?
    7·1 answer
  • Researchers randomly divide participants into groups. Each group takes a different amount of omega-3 fatty acid supplements dail
    5·1 answer
  • ¿Cual es la importancia de los pigmentos en las plantas?
    12·1 answer
  • Hãy nêu tóm tắt vai trò của các RNA không mã hóa (non-coding
    10·1 answer
  • How are the body systems used to address the basic needs of survival: food, water, sleep and shelter?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!