1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svp [43]
3 years ago
11

Requirements for ______ increase by 50% during pregnancy. rev: 03_07_2017_qc_cs-81797

Biology
1 answer:
Alla [95]3 years ago
4 0
Requirements for folate increase by 50 % during pregnancy, Folate plays a vital role in the production of red blood cells and helps the fetus neural tube to develop into her brain and the spinal cord.  Pregnant women are advised to increase folate in their diet as folate is important in that it helps to prevent neural tube and other birth defects. Tube defects are serious birth defects of the spinal cord such as spina bifida and the brain such as anencephaly.
You might be interested in
Type of joint found in the shoulder and hip?
Marta_Voda [28]
The <em>shoulder and hip joints</em> form the only ball and socket <em>joints</em> in the body.
8 0
3 years ago
Read 2 more answers
Muscles are attached to the bones by tendons.<br><br> True<br> False<br><br> I think true :)
Roman55 [17]
True very much ..............
5 0
3 years ago
Many songbirds breed in North America in the spring and summer and then migrate to Central and South America in the fall. They s
ololo11 [35]

Answer:

C.The two species do not breed in the same area, so they are reproductively isolated by allopatry.

Explanation:

Allopatry means that these two species are geographically separated during the breeding season, so they are reproductively isolated.

Allopatric speciation is a form of speciation (creation of new species) that occurs as a result of geographic isolation. This means that a part of population becomes physically separated from the initial main population. There is no gene flow between these two populations and as a result the two populations  reach a high level  of genetic divergence. They can no longer interbreed which means they become two different species (speciation).

7 0
3 years ago
Which of the following statements is the best explanation of why siblings who are not identical twins are not exactly the same?
vodka [1.7K]
Your answer will be c. each child receives some traits from each parent
6 0
3 years ago
Which of the following best describes the cell cycle?
Slav-nsk [51]

Answer: C.

Explanation:

Out of all of the answer choices, answer C most properly describes the cell cycle.

8 0
3 years ago
Other questions:
  • Why does your body need to break down starch into glucose ?
    10·1 answer
  • What will happen to an animal if all the mitochondria disappeared ?
    13·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • While snorkeling you come across an organism that appears to be a mollusk. In an effort to identify the type of mollusk you make
    10·1 answer
  • I need someone to help me with my homework in biology.
    6·1 answer
  • Explain why random orientation in metaphase ii is less important to genetic variation than random orientation in metaphase i.
    12·1 answer
  • The three main stages of the PCR process are usually repeated around 30 times over several hours. Approximately how many copies
    10·1 answer
  • Which part of an animal cell helps control the movement of material in and out of the cell?
    9·1 answer
  • CAN SOMEONE PLS HELP I HAVE TO SUBMIT THIS BY 1:30 ILL GIVE 40 POINTS
    13·1 answer
  • What if the function of bio molecules in the cell cycle?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!