1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
3 years ago
8

Please see attachment

Mathematics
1 answer:
LuckyWell [14K]3 years ago
7 0
The difference between the means is about 5 times
You might be interested in
14 to 35 simplest form
Llana [10]
14:35 is a ratio, and of-coarse, as we know, we can transform that into another way of writing a ratio:

14/35

Simplify

14/7 = 2
35/7 = 5

2:5

Answer: 2 to 5
3 0
3 years ago
Read 2 more answers
If a cylinder has a height of 10cm and a radius of 2.5cm then whats the surface area and the volume?
BlackZzzverrR [31]

Answer:

A≈196.35cm

Step-by-step explanation:

3 0
4 years ago
Read 2 more answers
Some help me please i have 9 questions
Lyrx [107]

awnser:

m<3=50

Step-by-step explanation:

seen in the picture if you need help let me know

5 0
3 years ago
A sample of 25 undergraduates reported the following dollar amounts of entertainment expenses last year:
marin [14]

Answer:

Range = 85

\sigma = 28.71

Interval = [666.78, 781.62]

Step-by-step explanation:

Given

The data for 25 undergraduates

Solving (a): Range and Standard deviation

The range is:

Range = Highest - Least

From the dataset:

Highest = 772

Least = 687

So:

Range = Highest - Least

Range = 772-687

Range = 85

The standard deviation is:

\sigma = \sqrt{\frac{\sum(x - \bar x)^2}{n}}

First, calculate the mean

\bar x = \frac{769 +691 +............+715}{25}

\bar x = \frac{18105}{25}

\bar x = 724.2

So, the standard deviation is:

\sigma = \sqrt{\frac{(769-724.2)^2 +(691-724.2)^2 +(699-724.2)^2 +(730-724.2)^2 +............+(715-724.2)^2}{25}}

\sigma = \sqrt{\frac{20604}{25}}

\sigma = \sqrt{824.16}

\sigma = 28.71

Solving (b): The interval of the 95% of the observation.

Using the emperical rule, we have:

Interval = [\bar x - 2*\sigma, \bar x+ 2*\sigma]

Interval = [724.2 - 2*28.71, 724.2 + 2*28.71]

Interval = [666.78, 781.62]

4 0
3 years ago
Value of the underlined of 56
Elodia [21]
Anyway, the value of 5 is 50 and the value of 6 is 6 as in the ones place.
5 0
4 years ago
Read 2 more answers
Other questions:
  • Janie flips a coin 70 times and records if it comes up heads. If getting heads is a success, what is the probability of a failur
    10·2 answers
  • How do you write 0.28 as a percentage
    10·2 answers
  • What is a classification for a triangle with angle measures of 20, 80, and 80 degrees,?
    15·1 answer
  • The ratio of points scored by 3 boys on a math test is 7: 10: 12. If the sum of their scores is 232 what is the highest score?
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Plz help me on this quick
    8·1 answer
  • 2y- x=-8 in slope intercept form
    14·1 answer
  • For my daughter please I give thanks and follwo
    12·2 answers
  • What is the equation of the graphed line written in
    9·1 answer
  • Solve for x in the following equation:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!