1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dusya [7]
3 years ago
7

Will give BrainlestThe change in energy consumption in the United States during the past 100 years is due to

Biology
2 answers:
tankabanditka [31]3 years ago
5 0

Answer:

A. Population Growth and Modernization

Explanation:

This is due to the increasing amount of people throughout time within the US. Not only is the population growthing increasing the demand for energy within the US but so is modernization. As we continue to advance within our society many more aspect of our lives require power and electricity therefor increasing the demand for it.

Aleksandr [31]3 years ago
3 0

Answer:

A:  Population growth and modernization

Explanation:

You might be interested in
The division of Earth’s history into smaller units makes up the ____. a. eras c. periods b. geologic time scale d. sequence of e
fenix001 [56]
B beacuse its is the best answer trust me boi
4 0
3 years ago
Read 2 more answers
Someone please answer
Margarita [4]

Answer:

out of the cell

bc water goes towards salt

4 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
You are a nephrologist. a 72 year old female patient presents with advanced kidney failure and you recommend the standard treatm
kirza4 [7]
<span>I suggest dialysis to the patient. Dialysis is a medicine. People who failed with the kidneys may have difficulty eliminating waste and unwanted water from the blood. Dialysis is an artificial way of carrying out this process. Dialysis substitutes the natural work of the kidneys.</span>
6 0
3 years ago
What is the most common mental health diagnosis for youth in detention and correction facilities?
Sav [38]

Depression is the most common mental health diagnosis

4 0
3 years ago
Other questions:
  • Please help! Can someone list organs in the digestive, respiratory and circulatory system please? I already have large intestine
    9·2 answers
  • Write a paragraph discussing the relationship between the organizational levels of the environment; biosphere, biome, community,
    10·1 answer
  • Jake designed an experiment to demonstrate interactions between Earth systems. He tied a clear plastic bag firmly around some le
    8·2 answers
  • In your own words why is genetic variation important and what could happen if there is not enough of it in a population?
    7·1 answer
  • A friend throws a coin into a pool. You close your eyes and dive toward the spot where you saw it from the edge of the pool. Whe
    12·2 answers
  • The epithelium of the esophagus is composed of which type of epithelial tissue?
    15·1 answer
  • CRQ QUESTION: A species of birds lives on an island. The thickness of the birds’ beaks varies within the population. The birds f
    11·2 answers
  • Which picture below shows an atom with 4 valence electrons?
    11·1 answer
  • What is the name of the indicator species in milk?
    7·1 answer
  • Please hurry
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!