1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
7

Give an example of a biological vector.

Biology
1 answer:
ICE Princess25 [194]3 years ago
7 0
A mosquito, because they are usually discussing an organism that can carry a virus or bacterial infection. Hope this helps
You might be interested in
The specific valve that prevents backflow of blood into the right ventricle when the ventricles relax is the ______________ valv
kaheart [24]
Pulmonary valve - connects right ventricle and pulmonary trunk (which divides into right and left pulmonary arteries). It is a semilunar valve
8 0
4 years ago
Why does a lot of rain form over West Ferris?​
Semmy [17]

Answer:

This idea helps explain why more rain forms over West Ferris than East Ferris.Therefore, when explain that water vapor condenses higher in the atmosphere, they are actually explaining that water vapor condenses high in the troposphere, which is relatively low in the atmosphere.

8 0
3 years ago
NEED ANSWER ASAP
vitfil [10]

Answer:

The answer is True because

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell.

6 0
3 years ago
A currently popular diet is the Keto Diet in which followers attempt to eat a diet high in protein and fats (lipids), and low in
tester [92]
Eat all the proteins no processed foods
All the green vegetables
Strawberries And Blueberries but watch how much you eat
Sugar free drinks
Ice sparkling water ready good
You can go on carb manager app and look it up or you can buy a ketosis book full of recipes and you can get a urine test for ketosis to see if your in ketosis it will change color if your in or not in ketosis
You can also get a glucose meter to see if your in ketosis as well hope this help have a wonderful day!
6 0
3 years ago
What are the sides of the DNA molecule made of?
stiv31 [10]

Answer:

the answer is

B. sugar and phosphates

6 0
4 years ago
Other questions:
  • How long does a baby chick develop in its egg
    14·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • The bond between H and H?
    13·1 answer
  • New Zella article called: how chromosome mutations occur. There are four questions on the quiz I can't get any of them. Please h
    15·1 answer
  • Que aporta la capa de nieve derretida?
    5·1 answer
  • [CM.05]Timothy made the model shown below to represent the steps in the formation of a tornado.
    5·2 answers
  • How is matter conserved in nutrient cycles
    14·1 answer
  • Identify these elements of photosynthesis.
    6·1 answer
  • Sound travels to your eardrum by way of the------?
    9·2 answers
  • Which example is an internal stimulus? help plz​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!