1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
3 years ago
6

What controls traits and inheritance

Biology
2 answers:
notka56 [123]3 years ago
7 0
GENE controls traits and inheritance
Sliva [168]3 years ago
7 0

Answer: for the edg test it’s nucleic acids.

Explanation:

You might be interested in
Muscles work together as a system to help your body move while adding support.<br> True<br> False
Mazyrski [523]

Answer:

true

Explanation:

7 0
2 years ago
Read 2 more answers
The coastal ocean zone and estuaries are alike in that both are important as breeding and nesting areas for birds. True or fuals
Citrus2011 [14]

Answer:

I think True

Explanation:

You can refer to it for more information:

The coastal ocean zone and estuaries are alike in that both are important as breeding and nesting areas for birds. The depth of the water in an aquatic ecosystem determines the amount of sunlight that living things receive there. ... The water in freshwater wetlands is always brackish

7 0
3 years ago
Mammals whose young develop in a pouch on the mother's body are called
DaniilM [7]
The correct answer is: marsupials.

Marsupials are actually defined by their ability to hold the young in the pouches, where they can be well protected. Some examples are Kangaroos and Koalas.


Other answers are wrong: for example, gymnosperms are plants, not animals.

4 0
3 years ago
Which term represents animals without backbones?
Art [367]

Answer:

invertebrates. animal's without backbone.

verterbrates- animals with backbone

5 0
3 years ago
Help! I just woke up and started doing school and now i have to take a quiz =/.
olga_2 [115]
For the first question the answer is Linnaeus

For the second question the answer is D, Organisms can be classified based on similar traits

For the third one the answer is C, the black snakes will survive and reproduce passing their traits to their offspring...

For the last one it’s A, some insects in a population survive temperature changes and pass their traits on to their offspring

Hope I helped!!
8 0
2 years ago
Other questions:
  • Where is the answer
    7·1 answer
  • During metaphase of meiosis I, homologous chromosomes and the alleles they possess are organized for distribution to different g
    11·1 answer
  • Name 11 organ systems
    5·1 answer
  • 1.) How and when is color added to a bird egg?
    15·1 answer
  • Why are small leaves an adaptation in a desert environment?
    11·2 answers
  • WILL GIVE BRAINLIEST - What has happened to the temperatures since the Ice age?
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How has our throw away consumer lifestyle affected the environment?
    10·1 answer
  • 8. if a chemist calculates the maximum amount of product that could be obtained in a chemical reaction, he or she is calculating
    14·1 answer
  • What is meant by acropetal succesion?​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!