1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
2 years ago
10

Read each description below and determine whether or not it describes a function or property of cerebrospinal fluid. Identify wh

ich of the followings are true or false.
a. Produces antibodies in response to antigen exposure in the brain tissue
b. Found in the ventricles of the heart and brain
c. Produced by the choroid plexus
d. Blocks blood toxins from brain tissue
e. Prevents concussions
f. Cardiac muscle contractions influence the flow of CSF
g. Compared to levels in the blood plasma, the CSF is higher in glucose.
h. Effectively decreases the brain's weight
i. Supplies oxygen to the brain tissue
j. Maintains the concentration of glycine surrounding the brain
Biology
1 answer:
Ostrovityanka [42]2 years ago
7 0

Answer:

Produced by the choroid plexus -T.This is the major secretion site.It is also produced in smaller quantities in the interstitial compartment.

Blocks blood toxins from brain tissue-F, that is the job of  the blood brain barrier(BBB).

Supplies oxygen to the brain tissue-T.This gas is dissolved  in the CSF together with CO2 for distribution among nervous tissues by the CSF

Maintains the concentration of glycine surrounding the brain-T

Found in the ventricles of the heart and brain-False,it does not reach the heart ventricles.This are occupied by blood.

Prevents concussions-T

Produces antibodies in response to antigen exposure in the brain tissue-False.These are produced by the B-cells, not by in the CSF,based on the  specif antigen stimulation.

Effectively decreases the brain's weight-T It reduces the weight of the brain.This is done by the buoyancy it provided for the brain.

Compared to levels in the blood plasma, the CSF is higher in glucose-F.This is wrong, the glucose of the blood plasma is higher.But equal sodium ion,more chloride in CSF, and less protein.It s levels is a relefection of blood glucose.Although it may lag 2-4hrs in the CSF.

It prevents concussion,(T)and and the contraction of cardiac muscles propels its movement(T).

Explanation:

You might be interested in
The key function of classical conditioning is to allow an organism to
nikdorinn [45]
The key function of classical conditioning is to allow an organism to <span>learn new species-typical behaviors.
Classical conditioning refers to when two or more different stimuli are joined in order for an organism to learn something it didn't know before. The more you repeat the conditioning, the faster the organism will learn. For example, Pavlov experimented with dogs - each time they were presented with food, they would also hear a bell. So each time dogs heard the bell, they knew that they would be getting food soon.
</span>
4 0
3 years ago
What are the most important arguments for and against driverless cars?
7nadin3 [17]

Pros:

Increase in safety.

Less traffic.

Reduced emissions.

Cons:

Eye-contact

Judgement Calls

Snow

Legal Responsibility

Cost

Lack of Trust

<u>There are many more, these are just a few.</u>

8 0
3 years ago
What happens once a person is infected with a heprevirus?
hram777 [196]
<span>Herpesviridae is a large family of DNA viruses that cause diseases in animals, including humans.

When a person infected once, his immune system develops antidot against the virus, so he becomes immune for that virus for rest of his life. In other words, he can't be affected from that virus again

Hope this helps!</span>
7 0
3 years ago
What is does the fossil record show?
Anit [1.1K]
The fossil record shows that life found on earth before was much different from life found on earth today.
3 0
3 years ago
Read 2 more answers
PLEASEE HELPPPPPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!!
Hatshy [7]
I think the answer is A
8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which structure of a protein is in the amnio acid sequence?
    6·1 answer
  • Can animals live in space?
    9·2 answers
  • What is ribose?...................
    11·2 answers
  • How does the amount of the Sun's energy the Earth receives change throughout the year?
    9·1 answer
  • 1. What is the study of the cosmos? The study of the cosmos includes what topics?
    12·2 answers
  • In which phase does DNA replication occur?
    6·1 answer
  • A student uses a marble simulation to illustrate genetic drift. She starts with a
    13·1 answer
  • Plantas de la herbolaria mexicana que usamos para calmar problemas digestivos??? AYUDAAA ES PA HOY ANTES DE LAS 10pm
    14·1 answer
  • Explain how it is possible for the north pole to receive insolation for 24 hours for 6 months, yet it
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!