1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
5

What power lens should he use as a magnifier to see clearly at a distance of 15 cm without wearing his glasses?

Biology
1 answer:
djyliett [7]3 years ago
4 0
<span>The focal length of the combination is given by 1/ f combination (1/fc ) = 1/f + 1/Fm </span>

<span>Assuming the the near point is 30 cm </span>

<span>1/f = 1/30 + 1/v </span>

<span>At 15 cm </span>

<span>1/fc = 1/15 + 1/v </span>

<span>1/fc = 1/15 + 1/f – 1/30 </span>

<span>1/fc – 1/f = 1/30 </span>

<span>1/f + 1/Fm – 1/f = 1/30 </span>

<span>1/Fm = 1/30 </span>

<span>Fm = 30 cm

Hope this answers. Have a nice day.</span>
You might be interested in
Eating a small serving of a food that is very acidic might present something of a paradox to your stomach because
Reptile [31]
 the presence of food in the stomach typically causes release of gastrin, but low pH inhibits release of gastrin.
6 0
3 years ago
Will a tree frog die if kept in glass jar
DiKsa [7]
Uh, if treated properly, with all it needs, then it'll be fine. but only if TREATED PROPERLY!!!!!!!
6 0
3 years ago
Read 2 more answers
Need help with 2. and 3. Thanks!
aleksley [76]

Answer:

Hair has 2 checks

Explanation:

I believe because if you read it you will see

6 0
3 years ago
Read 2 more answers
When muscle cells run low low on oxygen, Takes place
Hoochie [10]
Anaerobic respiration
7 0
3 years ago
Read 2 more answers
a race car driver drives one lap around a track that is 500 meters in length. what is the drivers displacement at the end of the
sleet_krkn [62]

Answer:

0 meters

Explanation:

When we talk about displacement, think that the think of it as the measure of the distance between the starting point of the object, from its end point.

Since we are talking about a lap around a track, it would mean that the starting point is also the end point. So if you started and end at the same point, the distance between it would be 0.

5 0
3 years ago
Other questions:
  • Some chemical signals are received by specific target cells. what is required for reception by a target cell?
    6·1 answer
  • Why would pushing a wooden block across a rough surface make the block warm?
    12·1 answer
  • How does polymerase chain reaction make DNA fingerprinting more reliable
    7·2 answers
  • What happens when the data in an investigation do not support the original hypothesis
    10·2 answers
  • The sharing of electrons is characteristic of<br> ionic bonds.<br> true or false??
    15·1 answer
  • A tiny skeleton found in chile might look like a alienher gense dont what is the central idea
    11·1 answer
  • Arthropod exoskeletons and mollusc shells both ________.a.are secreted by the mantleb.help retain moisture in terrestrial habita
    11·1 answer
  • Explain why, at point X, carbon dioxide is neither taken up nor given out by the tomato plants. (1)
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Definition of endocrine glands
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!