1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mel-nik [20]
3 years ago
9

Anti biotics drugs ...(types) ​

Biology
1 answer:
Mars2501 [29]3 years ago
7 0

Is there anything specific that you need or just any types of antibiotics??

You might be interested in
Which would be an adaptation in a very cold place, but not in a rainforest?
zysi [14]
Answer: The adaptations like paddy feet and fur on the outer body is an adaptation for very cold place but not for the rain forest. Explanation: If the outer body of the organism is made of fur then it will protect the inside body from cold and will provide warmth.
4 0
3 years ago
What of the following happens first?
slavikrds [6]
The answer is RNA polymerase binds to a promoter region of DNA.
5 0
3 years ago
The characteristics of all organisms and viruses are determined by the instructions carried in
Hatshy [7]

Answer:

DNA

Explanation:

maybe... BUT PROBABLY YESS

6 0
3 years ago
Read 2 more answers
How does the structure of white blood cells relate to its function
diamong [38]
<span> white blood cells tend to have a higher surface to volume ratio then other cells because the are more amorphous</span>
7 0
3 years ago
Please help me with my Science..?
liubo4ka [24]
The scientific theory of evolution states that populations change over time in response to changes in the enviroment
7 0
3 years ago
Read 2 more answers
Other questions:
  • When people exercise, their body cells build up more waste quickly. Which two body systems work
    6·2 answers
  • Which RNA nucleotide can pair with the Thymine (T) at the beginning of the strand? Drag it into the DNA antisense strand to make
    9·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following is true of environmental changes?
    9·1 answer
  • Help me please i need to know
    6·1 answer
  • This structure serves as the garbage collector / waste disposer for the cells: _____________________________
    12·1 answer
  • Packages proteins made by the ribosomes​
    14·1 answer
  • Which best describes the role of the esophagus in digestion ?
    5·2 answers
  • In digestion why do some food molecules decrease by the same amount that others increase.
    11·2 answers
  • Amoebas are single-celled organisms
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!