1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fed [463]
3 years ago
9

Drug a and drug b activate the same types of receptor sites. after repeated using of drug a, drug b would produce a _______ effe

ct.
Biology
1 answer:
True [87]3 years ago
3 0
Alcohol is the answers
You might be interested in
The suprachiasmatic nucleus of the ________ is responsible for regulating your circadian rhythms. In this way it plays a very im
Natalija [7]

Answer:

tiny region of the brain in the hypothalamus, situated directly above the optic chiasm.

3 0
3 years ago
Question 4 of 25
Katena32 [7]

Answer:

b if a bananas is grow in direct sunlight it will contain more potassium

3 0
3 years ago
In the process of embryonic development, which stage comes first?
arsen [322]
I believe the answer is D.
8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What happens when an electrical gradient and a chemical gradient are applying opposite forces to active transport?
Ierofanga [76]

Answer:

Option B, they negate each other

Explanation:

Electrical gradient force is more or less equal to the chemical gradient during an active transport. The number of electron produced during the establishment of chemical gradients, were transferred through the cellular circuit to produce electrical gradient of an equivalent amount in opposite path.

Thus, both electrical and chemical gradient are opposite to each other and hence they negate out each other.

Option B

8 0
2 years ago
Other questions:
  • How many amino acids are there
    8·1 answer
  • concerning sexual reproduction is it correct to say that it necessary in order for the individual to survive
    14·1 answer
  • explain why HHS workers should not impose their own values on their client while advocating for client needs?
    5·1 answer
  • The qualities and characteristics that shape a person's unique character and identity refer to
    13·2 answers
  • In which generation will there be almost 100% non-singing females if there are no changes in the birds’ environment and interact
    5·1 answer
  • WILL MARK BRAINLIEST!Which effect is most likely from a hurricane?
    15·2 answers
  • What is an example of stablizing selection
    11·1 answer
  • Who recognized the vital role of the internal environment and suggested that the objective of mechanisms within the body is to p
    6·1 answer
  • I need the organelle and it's role in analogy.
    11·2 answers
  • What is photosynthesis...?​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!