1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Digiron [165]
3 years ago
6

During chilly days, you might notice lizards lying (“basking”) in sunny areas. Why do lizards bask in the sun?

Biology
1 answer:
alukav5142 [94]3 years ago
8 0

Answer: The last one

Explanation:

You might be interested in
This is for today help me pls!!
pashok25 [27]

Answer:

I do not see the picture

Explanation:

4 0
3 years ago
Name a hormone secreted by the thyroid gland that acts to lower blood calcium
Sergio [31]

Answer:

Thyrocalcitonin or TCT

Explanation:

Thyrocalcitonin or TCT is a non-iodinated calcium lowering hormone. It is originating from the parafollicular cells or C cells (C for calcium).  

The thyroid gland consists of follicles of cuboidal epithelial cells. These cuboidal cells have a nucleus at the base. These are principal cells responsible for the synthesis of thyroid hormones.

 In between these follicular cells, other high cuboidal cells are present, known as parafollicular cells / C cells. These cells synthesise the hormone TCT. When there is high levels of calcium ions in the serum, TCT will release. This lowers the high level of calcium ions in the blood and plasma to normal level. This is done due to the deposition of calcium in the bone.

4 0
3 years ago
Can y’all help with this please ( the whole page)
Darya [45]

Answer: 8.B                  9.C               10.D              11.B          

Explanation: 12.?

4 0
3 years ago
Plants have structures which affect reproduction rates in plants.<br> A. True<br> B. False
natali 33 [55]

Answer:

True?

Explanation:

maybe I think true since different types of plants have different structures and because of the structures maybe a plant can reproduce like for a long time later and another plant can have a different structure and reproduce faster. I’m just 11

5 0
2 years ago
Read 2 more answers
NO ONE<br><br>literally no one.....<br><br><br>DAD BE LIKE:<br><br><br><br>OK *THUMBSUP*​
Feliz [49]
Dad: thumbs up sport
7 0
3 years ago
Read 2 more answers
Other questions:
  • Viruses are particles of DNA surrounded by a protein coat in which way do viruses depend on living cells
    13·1 answer
  • The atmosphere is an example of an exchange pool for water
    14·1 answer
  • A man with type a blood whose mother was type o is married to a woman with type ab blood. what are the blood types of their chil
    11·1 answer
  • Which of the following is a correct application of one of Darwin's postulates to the Galapagos finch data from Case Study #2?
    12·1 answer
  • African American history
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Make spindle fibers
    13·2 answers
  • What are parasites when cattle fights them off
    14·1 answer
  • Which muscle group supports the entire body? <br>A) Hips<br> B) Upper thigh <br>C) Legs <br>D) Feet
    8·1 answer
  • Which one is an example of natural selection?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!