1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
10

Select all that apply.

Biology
2 answers:
11Alexandr11 [23.1K]3 years ago
6 0
 results in genetic variation, takes time and energy 
andriy [413]3 years ago
4 0

I think the correct anwers are takes time and energy and requires a mate.

You might be interested in
Who was the first person to propose a heliocentric model of the universe
irina [24]
Hello There!

It was a Greek astronomer called Aristarchus of Samos.

Hope This Helps You!
Good Luck :) 

- Hannah ❤<span />
4 0
3 years ago
Read 2 more answers
Which of these rocks forms from lava that cools very quickly?
dimaraw [331]
I am thinking the rock that forms from lava that cools quickly is D) Obsidian.
7 0
4 years ago
Read 2 more answers
What are similarities of igneous and sedimentary rock
Sedaia [141]

Differences and similarities between igneous , metamorphic , and sedimentary rocks . sedimentary rocks are formed by weathered sediment using cementation or precipitation on Earth's surface . Metamorphic rocks are formed by changes of pressure and temperature within Earth's surface .

3 0
3 years ago
Read 2 more answers
What biometrics are measured to determine growth in a forest?
noname [10]
The biometrics used to determine growth in a forest are the number, variety, size, shape, and age of trees. 4. How can forests remove timber and still remain sustainable? Forests can remove timber and still be sustainable because sustainability just means that only the growth is removed.
7 0
3 years ago
Read 2 more answers
Many parents do not allow their children to play with toy guns. In your opinion, is this a wise decision? Explain what you think
Natalka [10]

Answer:

It doesn't really matter either way they prolly going to shoot up a school. :/

Explanation:

4 0
3 years ago
Other questions:
  • Which of the following is an example of maintaining homeostasis? Learning Jumping Shivering Smiling
    10·2 answers
  • What instrument was necessary before the cell theory could be developed?
    11·1 answer
  • Salt dissolved in water is a solution, therefore _____
    13·2 answers
  • Why do you think people believe some theories even if they´re not supported by scientific evidence?
    6·1 answer
  • Tortoise shells and snail shells are similar in function: they protect the organism from predators. Based on a comparison of the
    7·2 answers
  • Formation of the enzyme pepsinogen in the correct order
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Answer f and g urgently <br>it relates to the picture ​
    15·2 answers
  • Example of natural system of classifying organisms​
    10·1 answer
  • (0)<br> The stage of mitosis depicted in the image is<br> es )<br> A)<br> anaphase<br> B<br> interphase<br> 0<br> prophase<br> D
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!