1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julsineya [31]
3 years ago
10

How would the infection simulation you performed in the last activity have been different if you had performed it for syphilis?

what about for malaria?
Biology
1 answer:
Ket [755]3 years ago
4 0
Syphilis is transmitted through sexual actions through small cuts, for malaria, it would have to be through mixing of blood from a contaminated source to a uncontaminated source.
You might be interested in
What is the term that refers to the range of animal and plant species and the genetic variability among those species?
Gemiola [76]

Answer:

Biodervasity.

Explanation:

The term refers to the variety of life on earth.It demonstrates the extent of variation at different levels of species,genetic and ecosystem in a community of organisms.

It not equal in its distribution on earth;but rather varies with the type of ecosystem available and the distribution of biotic and abiotic factors in the ecosystem. For example;

It is highest in the Tropics,due to the species richness and diversity of the region. However, it varies in other ecosystem based on species diversity peculiar to parts of the region .e.g it is highest in the marine ecosystem along the coast of abundant temperature for primary producers.

7 0
3 years ago
Which area of the brain is linked to emotions such as fear.
faust18 [17]

limbic system

Explanation:

center of emotional processing is the amygdala

6 0
2 years ago
How do chemical companies contribute to acid deposition in the environment?
steposvetlana [31]

stems and leaves

roots and stem

leaves and roots

6 0
3 years ago
CuxugcgyducyufxhtsckfvjdckrfkorhxthxlyphzriditZgvivicujhihuxuvobrCjkbgu
azamat

I believe the correct answer is A.

8 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • What are some possible things that you as a disease outbreak expert can do to help?
    5·1 answer
  • The long-term survival of any species of an organism is possible only if the organism can
    12·1 answer
  • Explain the role of organic compounds in cellular respiration
    14·1 answer
  • !!10pts!! Answer correctly answer please!! Exclamation to please for comfort
    9·1 answer
  • A species of moth has evolved a very long tongue to reach nectar at the bottom of a species of orchid. This orchid has evolved a
    15·2 answers
  • This was simulation. What are some variables that this peppered moths simulation does not address?
    11·1 answer
  • Based on this information what is the probability of producing a P plant with green seeds in a yellow pod?
    7·1 answer
  • 4. Sunlight, water, and carbon dioxide are environmental factors that affect the rate of photosynthesis?
    14·1 answer
  • Since more heat is being radiated down to Earth from the excess greenhouse gases in the atmosphere, scientists predict an increa
    10·2 answers
  • The fluid in the bowman's capsule contains the same substances as blood plasma except it lacks?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!