1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
10

Why must meiosis and not mitosis be used to produce gametes?

Biology
1 answer:
Inga [223]3 years ago
3 0
This is because meiosis divide the total chromosomes number by half its original number (2n/2 = n) which would be combined with the haploid egg cell to produce a diploid (2n) zygote white mitosis maintains the chromosome number.
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Which of the following statements is true about Tiktaalik?
yawa3891 [41]

Tiktaalik is a transitional fossil which shows how fish evolved into amphibians and reptiles. So the correct option is B.

What is Tiktaalik?

Tiktaalik is a direct ancestor of tetrapods or four-legged animals. It is an extinct fish-like animal and it lived on earth 380-385 million years ago (Devonian period).

The word Tiktaalik is derived from the <em>Inuktitut</em> language which loosely translates to large freshwater fish. This animal had characteristics of both fish and tetrapod and is therefore called the link between these two kinds of animals.

The characters resembling fish are gills and scales and the characters resembling tetrapods are rib bones, movable neck and lungs. There are characters that are a mix of both tetrapods and fish. These are bones and joints in limbs but fish-like fins instead of feet or hands.

Read more about Tiktaalik, here

brainly.com/question/10138798

#SPJ1

8 0
2 years ago
What type of charge does each atomic particle have?<br> Proton<br> Neutron<br> Election)
nadya68 [22]
Answer:

Proton has a positive charge.
Neutron has a neutral or no charge.
Electron has a negative charge

Explanation:

Trust me
3 0
2 years ago
What’s the difference between a clementine and a tangerine?
ladessa [460]

Answer:

A tangerine is a fruit and Clementine is a character from the walking dead the game.

Explanation:

7 0
2 years ago
Predict how an ecosystem would respond if either its producers or decomposers
krok68 [10]

Answer:

The ecosystem would collapse if producers were removed.

Explanation:

The primary consumers populating would decrease due to lack of food and if a species doesn’t have food they most likely won’t reproduce. The secondary consumers won’t have enough food either because their prey being the primary consumers would die off. All this leads to the down fall of ecosystem.

5 0
3 years ago
Other questions:
  • An example of chemical digestion is the breakdown of __________ into __________.
    14·1 answer
  • What force between the ocean and the wind causes surface currents
    12·2 answers
  • Respond to the following based on your reading. A type of tissue called _______ tissue is responsible for communicating between
    11·2 answers
  • For what percentage of time has life existed on earth round to the nearest whole number
    6·2 answers
  • Plants are to the carbon cycle, as __________ are to the nitrogen cycle
    7·1 answer
  • What are three things that are necessary for something to be considered living?<br> Answers
    14·2 answers
  • How does food move around in a plant ?
    11·1 answer
  • FIRST ONE WHO ANSWERS THIS QUESTIN WILLLL BEEE MARKED BRAINLIEST.
    7·2 answers
  • Are dolphins endangered
    13·2 answers
  • Please help me out with this one
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!