1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
2 years ago
13

Which statements about the phylogenetic tree are true?

Biology
1 answer:
Alex777 [14]2 years ago
5 0

Image is not avilable fo rthe question. The image is attached below:

The phylogenetic tree shown here displays the major clades of chordates.

Which statements about the phylogenetic tree are true?

A) Organism (c) is a common ancestor of lampreys and lungfishes.

B) Birds and ray-finned fishes have a notochord and jaws.

C) Lancelets and coelacanths are more closely related than are chimaeras and coelacanths.

D) Mammals and turtles are more closely related than are lungfishes and sharks.

E) Rays and frogs have vertebrae.

F) Descendants of organism (d) have limbs with digits.

G) Hagfishes, lungfishes, and frogs have lobed fins.

H) Organism (a) is a common ancestor of all chordates.

Answer:

B, D, F, E, H.

Explanation:

A phylogenetic tree is a diagram representing evolutionary relations between species. Phylogenetic trees are not conclusive evidence nor theories. In a phylogenetic tree the pattern of branching illustrates how organisms or other groups developed from a set of similar ancestors.

Some of the examples of phylogenetic tree are as following:

  • A notochord and jaws includes in birds and ray-finned fishes.  
  • Mammals and tortoises are closer to one another than lungfish and sharks are.  
  • Organic Descendants (d) have wings.  
  • Rays and frogs are columned vertebrally.  
  • A shared ancestor of all chordates is the organism (a).

Hence, the true options are B, D, F, E, H.

You might be interested in
Which of the following neurotransmitters typically has inhibitory effects?
solmaris [256]

The correct answer is: A) GABA

GABA or γ-aminobutyric acid is a type of amino acid that's found in proteins. It is the main inhibitory neurotransmitter in the brain which means that GABA reduces neuronal excitability throughout the nervous system. GABA binds to its receptors that are located on the neuron’s plasma membrane. This binding causes the opening of ion channels that transport chloride ions into the cell or potassium ions out of the cell.

6 0
2 years ago
If someone is blood type O, then their blood contains antibodies for which antigens?
s344n2d4d5 [400]

Answer:

D I think

Explanation:

4 0
2 years ago
Read 2 more answers
What are three examples of matter besides water that are transported through ocean currents
ololo11 [35]
Matter is anything that has mass. everything has matter, even the air.
7 0
3 years ago
Which statement below can NOT be used
Solnce55 [7]
Answer is B same as the weight of that
7 0
3 years ago
Which vital sign can be controlled consciously?
GuDViN [60]

Answer: Respirations

Explanation:

6 0
1 year ago
Other questions:
  • All cells whether they are Prokaryotic or Eukaryotic have a selectively/semi permeable cell membrane that allows certain things
    12·1 answer
  • Why do isolines end near the shorelines of the oceans
    11·1 answer
  • Which activity would contribute the most to water pollution?
    14·2 answers
  • 5. What causes a thunderstorm to end?
    14·1 answer
  • When do plant need their mitochondria ?
    11·1 answer
  • A monkey has 42 chromosomes in almost all its cells. How many chromosomes are in a monkeys haploid cells?
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The fluidity of the cell membrane is
    13·1 answer
  • biết gen A quy định hat vàng trội hoàn toàn so với gen a quy định hạt xanh nằm trên NST thường . cho cây vàng tự thu phấn , kiểu
    9·1 answer
  • What is an acid?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!