1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vesna_86 [32]
3 years ago
12

Which of these best describes what occurs during cytokinesis?

Biology
2 answers:
larisa86 [58]3 years ago
3 0
Cytokinesis occurs after mitosis is complete. It is when two daughter cells are formed, each with their own nuclei, after a single cell has <em>completely </em>divided.
abruzzese [7]3 years ago
3 0

Cells begin the process of dividing

You might be interested in
What nineteenth-century invention led to the expanded use of hydroelectric power?
Dimas [21]

Turbines. Invented by Charles Parsons. I know I'm in middle school, but we are just learning about hydroelectric power.

5 0
3 years ago
Read 2 more answers
Red flowers (r) and white flower (w) are crossed to produce a pink flower (rw). what is the probability of a red flower, if 2 pi
Dafna11 [192]
I think the probability will be 0 then.
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Mimicry is
Rufina [12.5K]

Answer:

C. when an origanism changes tropic levels to look like another organism

6 0
3 years ago
Read 2 more answers
Kristen cut her hand on a piece of glass. As the blood clots, how do white blood cells prevent bacteria on the glass from infect
Mama L [17]

The right option is ; They destroy pathogens that enter the wound  

White blood cells will prevent bacteria on the glass from infecting her blood by destroying the bacteria.

White blood cells are the cells of the immune system that protects the body against infectious disease and pathogens. White blood cells are present in every part of the body including the blood. White blood cells encompass any pathogens in the blood, engulf and break them down so as to destroy them .


3 0
3 years ago
Read 2 more answers
Other questions:
  • Typically best practices would dictate that a guest account would be placed in a(n) __________, isolated from the production net
    14·1 answer
  • Explain what distinguishes primary and secondary consumers
    7·2 answers
  • What is the melting point of a substance?
    14·2 answers
  • Which shows the correct order of forces, from weakest to strongest?
    15·1 answer
  • The cohesion-tension theory proposes that the physical properties of water allow the rise of water through a plant. Sketch and d
    6·1 answer
  • Many Learners Perform Well In Grade 12 But still not accepted into Universities.Explain Two Reasons For This​
    6·1 answer
  • Using as much of the vocabulary below,
    5·1 answer
  • Why is it dangerous to not take all your antibiotics prescribed? How will that affect the evolution of that bacteria?
    13·1 answer
  • How can biodiversity be protected at global level, species level and genetic level​
    12·1 answer
  • Fracking is a way to obtain oil and natural gas trapped in rock. during
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!