1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cupoosta [38]
4 years ago
9

Benedict's solution is added to maple syrup and heated. The color changes from blue to orange. Based on this result, what biolog

ical molecules are present in the maple syrup?
Biology
1 answer:
borishaifa [10]4 years ago
7 0

The Benedict's solution or the Fehling's solution is a chemical solution with clear blue color, which is a combination of the sodium citrate, sodium carbonate, and cupric sulphate pentahydrate. The Benedict's solution is used to test for the presence of the reducing sugars, such as glucose. When it is added into a solution and warmed, and it changes the color to orange, it confirms the presence of the reducing sugar in the testing solution.

Hence, the maple syrup contains reducing sugar.

You might be interested in
Which of these tools is used to transfer a gene into an animal?
Kisachek [45]
B they are <span>used for the process of gene transfer</span>
3 0
4 years ago
Where do the instructions for determining the sequence of amino acids that make up a protein originate at?
yaroslaw [1]

The process in which the genetic code carried by mRNA is translated into a sequence of amino acids. Occurs on ribosomes. Protein synthesis begins with DNA. The reason for this is simple: DNA contains the genetic information for everything in our bodies.

3 0
3 years ago
Viral or bacterial germs that invade body cells are called _____.
Rufina [12.5K]
It may be pathogens I hope this is right!
3 0
3 years ago
Read 2 more answers
You overheard a classmate in the hallway say the following statement.
notsponge [240]
I would say, no it gets colder because you become exposed to space where heat isn’t trapped in
5 0
4 years ago
Read 2 more answers
Unlike the carbon cycle, the phosphorous cycle does not involve
MrRissso [65]
<span> The right answer is </span><span> c. human activity. Phosphorus cycle takes place even without human involvement but it can still affect or cause major changes in this nutrient cycle. </span>Humans use fertilizers and raise livestock (hogs). Waste from livestock and fertilizers are high in phosphate that gets into the soil and bodies of water through drainage and run-off.
5 0
3 years ago
Other questions:
  • Why did Gregor Mendel choose to use purebred plants in his experiments?
    6·1 answer
  • Land degredation is a major issue worldwide and poses a threat to the sustainability of agriculture and economic development of
    14·2 answers
  • Which of these is a nessacary condition for a hypothesis to be useful
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Suppose a rancher wants to raise cattle. Design a plan to help the rancher determine how much land she'll need based on the ener
    13·1 answer
  • Which of the following is not one of the four basic types of tissue in humans? a. connective c. nerve b. muscle d. phloem Which
    11·1 answer
  • A person with sickle cell trait has ___ mutated copies of the hemoglobin gene, a person with sickle cell disease has ___ mutated
    10·1 answer
  • What are the two means of moving large molecules across the cell membrane with energy
    8·1 answer
  • Help me please!!!
    5·1 answer
  • Which of these provides evidence from developmental biology of a shared evolutionary history?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!