1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
13

What is the powerhouse of the cell?

Biology
2 answers:
grigory [225]3 years ago
5 0

Answer:

Mitochondria

<em>Hope that helps! :)</em>

<em></em>

<em>-Aphrodite</em>

Explanation:

Illusion [34]3 years ago
5 0
The mitochondria is the answer
You might be interested in
What combination of sex chromosomes is shown in the image?<br> o<br> Please help a boi out ;-;
mestny [16]
C)XY ...............
5 0
3 years ago
Read 2 more answers
Question
cricket20 [7]

Answer:

substitution

Explanation:

c replaces g. does not cause a frameshift mutation so it is not insertion or deletion, and i have no clue what corruption is when there is the word "replace" it is probably substitution.

8 0
2 years ago
Read 2 more answers
an organism is classified as a carnivore. is it a heterotroph or an autotroph? is it a producer, consumer, or decomposer?
kobusy [5.1K]

Heterotroph. Consumer

3 0
3 years ago
In Kerr and Wright's experiment with 96 fruit-fly populations, only 4 males and 4 females bred in each generation. After 16 gene
Svetradugi [14.3K]

Answer:

2.Less than 73% of the populations would have only one allele present.

Explanation:

The two alleles chosen do not affect the fitness of flies in the lab environment, so Kerr and Wright could be confident that if changes in the frequency of normal and forked phenotypes occurred, they would not be due to natural selection.

Using a larger breeding population would not be expected to alter the outcome of the experiment.

3 0
3 years ago
How many ATP are generated in the election transport chain
Margaret [11]

Answer:

32 ATP

Explanation:

3 0
3 years ago
Other questions:
  • What class of organic molecules does cholesterol belong to?
    9·1 answer
  • In a certain plant species, the allele for yellow seeds (Y) is dominant to the allele for green seeds. What is the phenotype res
    15·1 answer
  • How are plants pull toward the sun
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • An artist is reviewing plans for a granite statue. The statue will be displayed outdoors. How could the plans be revised to redu
    6·1 answer
  • Which of the following is a biotic factor?
    5·2 answers
  • According to a recent encyclopedia entry about dog breeds, Labrador retrievers come in two specific breeds: English and American
    6·2 answers
  • By raising their pressure-temperature enough, rocks may form
    15·1 answer
  • Hello beautiful people on this earth.... I need some help asap please and thank you! :)
    5·1 answer
  • In a food chain the flow of energy is Always___.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!