1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
2 years ago
8

What is the equation for the Krebs cycle?

Biology
1 answer:
Dominik [7]2 years ago
8 0

Answer:

Acetyl-Coa + 3 NAD + + Q + GDP + Pi + 2H2O >

CoA-SH + 3 NADH + 3 H + + QH2 + GTP + 2 CO2

Explanation:

You might be interested in
The _____ detect shades of grey and is/are responsible for peripheral vision, which the ______ is/are responsible for color visi
VMariaS [17]
The RODS detects shades of grey and are responsible for peripheral vision, while the CONES are responsible for colour vision and seeing fine details. 
Rod cells are photoreceptor cells that are located on the retina of the eyes. Rods cells are usually concentrated at the outer edge of the retina and they are use in peripheral vision. Cones on the other hand are photoreceptor cells which are responsible for colour vision and they work best in bright light.
7 0
2 years ago
What is a cell made out of
slega [8]

Answer:

Two-thirds of a cell is water, which means that two-thirds of your whole body is water. The rest is a mixture of molecules, mainly proteins, lipids and carbohydrates.

5 0
3 years ago
Eukaryotic plasma membranes can contain cholesterol, which tends to make the membrane more stable.
7nadin3 [17]

Answer: true

Explanation: in able to do this it has to transport proteins that can span the cell membrane and allowi the permeable membrane to regulate which molecules enter and leave a cell.

Question answered by:

                            (jacemorris04)

8 0
2 years ago
If a person eats hurriedly and barely chews his food before swallowing it, what effect will it likely have on his stomach?
weqwewe [10]
Well to be fair no matter what happens, a will always happen no matter how wholly fold is chewed. However because chime is the byproduct of chewing and saliva. Your body must be able to break down the food into a smaller and easy to absorb form so if you can't do it with the mouth, the stomach is just going to have to do the job.

So "D" is the correct answer
4 0
3 years ago
Read 2 more answers
____________________ is the consequence of dilation of arterioles and the resultant influx of blood in the capillaries, which oc
borishaifa [10]

The active hyperemia is the consequence of dilation of arterioles and the resultant influx of blood in the capillaries, which occurs during blushing or excercise.

<u>Explanation:</u>

The rise in organ blood circulation correlated with an organ or tissue having elevated metabolic activity is understood as active hyperemia. An illustration of active hyperemia is the rise in blood flow that follows muscle contraction, also named skeletal muscle activity or responsive hyperemia.

It typically occurs when blood is needed by the organs more than normal. Your blood vessels are expanding to improve blood running in. Reactive hyperemia is the blood circulation reaction to occlusion of blood flow, while active hyperemia is the blood flow result of increased metabolic activity of the tissue.

6 0
3 years ago
Other questions:
  • A cell with two pairs of each set of chromosomes is called what ?
    5·1 answer
  • Need help with this etm class
    12·1 answer
  • 3)Suppose you suffered a rib injury that inhibited your ability to take regular breaths due to the pain. If you needed to mainta
    6·1 answer
  • Which phrases describe groundwater? Check all that apply.
    14·2 answers
  • If two O blood group parents get married what is the probabilty of getting a baby with A blood group?
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • HOW DO I FIND THE PERCeNT
    10·2 answers
  • What do scientists estimate is the approximate age of earth?.
    12·1 answer
  • The vegetative body parts of a higher plant is made up of-----------,------------and----------.​
    7·1 answer
  • In order to keep DNA organized it wraps around proteins called histones to form? NucleotideChromosomesBase pairGenes
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!