1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
4 years ago
10

In certain Native American groups, albinism due to a homozygous recessive condition in the biochemical pathway for melanin is so

metimes seen. If the frequency of the allele for this condition is 0.06, which of the following is closest to the frequency of the dominant allele in this population? (Assume Hardy-Weinberg equilibrium.) (1999:54)
a. 0.04
b. 0.06
c. 0.16
d. 0.36
e. 0.94
Biology
1 answer:
Arlecino [84]4 years ago
4 0

Answer:

e .94

Explanation:

u have to do 100 - 0.06 to get 0.94

You might be interested in
Is food niche or habitat<br>​
djverab [1.8K]

Answer:

habitat

Explanation:

habitat is part of the ecosystem

niche describes ahow different organisms are linked

4 0
3 years ago
Respiration involves the breakdown of sugar. This process results in the production of energy for the cell. In order for cells t
Lerok [7]
The answer is letter A. In most organisms cellular respiration usually involves oxygen to produce the most energy. Except in the process of fermentation, where the cells are deprived with oxygen causing it to form bacteria and other forms of organisms within the fermented sample.
8 0
3 years ago
The most abundant element in the sun is heliumargonhydrogenoxygennitrogen.
KATRIN_1 [288]
Hydrogen is abundant in the sun.
7 0
3 years ago
Read 2 more answers
What is the physical description of sulfur
Olenka [21]
The physical description of sulfur is hydrogen
8 0
3 years ago
What parts of the world are deserts located???
MA_775_DIABLO [31]
Dry and arid parts of the world with little to no rain.
5 0
4 years ago
Other questions:
  • Which of these natural resources is used for making rubber? A. sulfur B. copper C. titanium D. aluminum
    11·1 answer
  • Write the biological mechanism involved in breathing.
    5·1 answer
  • Which indicator most likely suggests that a chemical change is taking place?
    9·2 answers
  • Enzymes are substances that speed up the rate of chemical reactions. The rate of enzyme
    7·1 answer
  • Rank these events in the order that they occur during the repair of double-strand breaks by recombination:
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which diagram correctly displays the order of events during egg formation?
    10·2 answers
  • Why do people who exercise need more calories than people who don't exercise?
    8·1 answer
  • All of the following describe outcomes of urbanization except
    10·1 answer
  • Which enzyme is used to break down bacteria, yeast, and other microorganisms?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!