1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trasher [3.6K]
3 years ago
8

What stores digestive enzymes that break down lipids, carbohydrates, and proteins into small molecules that can be used by the r

est of the cell?
Biology
1 answer:
marusya05 [52]3 years ago
5 0
Lysosome

This part of the cell contains strong digestive enzymes to break down proteins, carbohydrates and lipids into small molecules that can be used by the rest of the cell.
You might be interested in
Can a mutation in any cell of an organism can be passed on to offspring of the organism
kozerog [31]
Yes it can (I have to type 20 characters)
8 0
4 years ago
How can mutations be helpful? Give 2 examples
RSB [31]
Having two copies of the mutated genes cause sickle cell anemia, but having just one copy does not, and can actually protect against malaria - an example of how mutations are sometimes beneficial. 

The majority of mutations have neither negative nor positive effects on the organism in which they occur. These mutations are called neutral mutations. Examples include silent point mutations. They are neutral because they do not change the amino acids in the proteins they encode.

Hope this helped :)
6 0
4 years ago
PLEASE JUST ANSWER DO NOT ATTACH IMAGE
anzhelika [568]

Answer:

D

Explanation:

Im not exactly for sure on this one, but if i were you, i would choose either A or D . Homeostasis is like the normal for something when they it isnt sick. Its when they are doing good with not really any concerns!

4 0
3 years ago
Read 2 more answers
The members of these kindoms all have cell walls. Which kingdoms are they?
Kazeer [188]

Answer:

Plantae, Archaebacteria, Eubacteria, and potentially fungi. I say potentially because I am not 100% certain if all organisms falling under the category of fungi contain cell walls.

7 0
3 years ago
Six million years ago, hominids had ____________ compared to present-day hominids.
Inessa [10]
I believe the answer is a
7 0
3 years ago
Other questions:
  • What is the answer to this question?"explain two difficulties an ecologist might have in counting a population of migratory bird
    12·1 answer
  • Oxygen-rich blood is sent to the rest of the body through the _____.
    14·2 answers
  • What are all the reasons why ketone bodies are produced in the body?
    13·2 answers
  • What part of the plant is responsible for making food?
    5·1 answer
  • What type of waste does the digestive system get rid of
    10·2 answers
  • How are most nutrients absorbed through the mucosa of the intestinal villa? A. facilitated diffusion B. bulk flow C. active tran
    5·1 answer
  • Explain the role of nitrifying bacteria and denitrifying bacteria during nitrogen cycle
    11·1 answer
  • Which of the following is an example of potential energy?
    14·1 answer
  • Please help me out once again
    13·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!