1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
5

What is the genotype of the offspring missing on the first row of the punnett square?

Biology
2 answers:
xenn [34]3 years ago
7 0
Yeah i think c as well
Len [333]3 years ago
6 0
I believe the answer is C.
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which of these options represents the correct flow of events during meiosis II?
Nuetrik [128]
The correct answer is A.) Sister chromatids pulled to opposite pole, nucleoli form, cytokinesis.  
4 0
2 years ago
Read 2 more answers
Find the surface area of the prism. Use the net to help.
Masja [62]
Finding the areas of each of the rectangles and squares of the net of a rectangular prism and adding up those areas gives the surface area or total surface area of the prism. For example, if the length of one side of the cube 4 units then the area of one its face is 4 × 4 = 16 square units.
8 0
3 years ago
Read 2 more answers
what role does molecular evidence play in determining how closely two species are related to each other
qwelly [4]
Recall the endosymbiosis hypothesis and recall endosymbiosis. Remember that the very first cell was a prokaryotic cell. Which engulfed chloroplast precursors and mitochondria. We all come from these cells. And how we evolved over time shows the relationship. I'm a bio major hope I helped
5 0
3 years ago
Rank the following in order from most general to most specific: 1. gametic isolation 2. reproductive isolating mechanism 3. sper
mihalych1998 [28]
<h2>Reproductive Method </h2>

Explanation:

<em>The rank in order from the most specific which is following .</em>

<em>(1) Reproductive isolating mechanism</em>

<em>(2) Sperm-egg incompatibility in sea urchins</em>

<em>(3) Gametic isolation </em>

<em>(4)Prezygotic isolating mechanism</em>

<em>(1) Reproductive isolating mechanism-</em> The components of regenerative confinement are an assortment of transformative instruments, practices and <em>physiological procedures basic for speciation.</em> They keep individuals from various species from delivering posterity, or guarantee that any posterity are sterile.

(<em>2) Sperm-egg contradiction in ocean urchins-</em> Bindin is a gamete acknowledgment protein known to control species-explicit <em>sperm-egg grip</em> and layer combination in ocean urchins.

<em> (3)Gametic isolation - Prezygotic hindrances </em>keep preparation from occurring. Gametic disengagement is a sort of prezygotic hindrance where the<em> gametes (egg and sperm) </em>come into contact, yet no preparation happens. Gametes might be not able to remember each other in various species  

<em> (4) Prezygotic isolating mechanism- </em>while postzygotic segregation forestalls the arrangement of rich posterity. Prezygotic systems incorporate environment segregation, mating seasons, "mechanical" disconnection, gamete detachment and conduct seclusion. 

4 0
3 years ago
Other questions:
  • T or f bipolar disorder is a type of depression in which a person experiences periods of sadness and happiness
    11·1 answer
  • How could the action force of a canoe moving through water be increased?
    5·1 answer
  • What are examples of of genetic engineering? Check that all apply.
    9·1 answer
  • Choose the incorrect statement concerning centrioles.
    9·2 answers
  • 3. Which of the following is a major functional characteristic of all organisms? (a) movement,
    7·1 answer
  • There are many types of proteins found in the cell membrane. These proteins interact with internal and external environment.
    14·1 answer
  • I need a thesis statement about whether or not transgender women should be allowed to compete in biological females sports. Plea
    5·1 answer
  • Good morning everyone!!! 3+4
    14·2 answers
  • Two organisms are shown in the diagram below.
    13·2 answers
  • Amelia makes a Venn diagram to compare the advantages and disadvantages of asexual reproduction and sexual reproduction.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!