1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
10

This simple bacteria cell has the same structure as more complex cells. It controls what comes in to and leaves the cell and als

o maintains homeostasis. It is the
Biology
2 answers:
slega [8]3 years ago
8 0

Answer:

It is the membrane

Explanation:

Trava [24]3 years ago
5 0
The correct answer is a eukaryotic cell. The eukaryotic cell is a bacteria cell that has the same structure as more complex cells. Eukaryotic cells have many structures that help to maintain homeostasis and also to provide energy for the protein synthesis.
You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
How fast can you answer correct..? How fast can i give you brainliest. Explain Your answer:D/ HELP..............................
Vilka [71]

Answer: A.

Explanation:Weather radar, also called weather surveillance radar (WSR) and Doppler weather radar, is a ... Between each pulse, the radar station serves as a receiver as it listens for ... If pulses are emitted too frequently, the returns from one pulse will be ... Over the area covered by radar echoes, a program assigns a precipitation type

5 0
2 years ago
Read 2 more answers
1. What are viruses made up of?
puteri [66]

Answer: bateria

Explanation:

3 0
3 years ago
Read 2 more answers
Which of the following is not a piece of molecular evidence supporting the endosymbiotic theory? .A. Some organelles divide by f
ElenaW [278]
The best answer is B. The endosymbiotic theory states that mitochondria and chloroplasts have striking similarities to bacterial cells: 1. they have their own DNA, which is separate from the DNA found in the nucleus of the cell. 2. Both organelles use their DNA for to produce many proteins and enzymes required for function. 3. They are both surrounded by a double membrane. 4. They reproduce just the way bacteria do, replicating their own DNA and directing their own division.
6 0
3 years ago
Name facts on the blue ridge of virginia please!
Katen [24]
Eastern range of appalachian mountains
4 0
3 years ago
Other questions:
  • What is a scientific explanation that is widely accepted and based on a vast amount of evidence?
    9·1 answer
  • Please help me out here
    10·1 answer
  • 1. In which set is a biotic factor paired with an abiotic factor?
    10·2 answers
  • What is an ethical concern regarding genetic engineering? privacy of genetically tested individuals unnatural and potentially da
    14·1 answer
  • Like poisonous dart frogs, monarch butterflies are brightly colored. What might be adaptive advantage of bright coloration?
    11·2 answers
  • 1 How was the Flowing Water Model similar to
    11·1 answer
  • What is the carrying capacity of this ecosystem?
    15·1 answer
  • Carbon is transformed into stored energy in what process
    6·2 answers
  • Can someone pls help me with these two question pls I would really appreciate it. I’ll give brainliest to whoever answers it cor
    15·2 answers
  • During metaphase, the chromosomes are ______.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!