1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katen [24]
3 years ago
9

Which phenomenon does not require the air temperature to be at 0°c?

Biology
1 answer:
MariettaO [177]3 years ago
8 0

CLOUD FORMATION, he said it under the question but i put it here so it would be easier too find

You might be interested in
The New Mexico whiptail Lizard can reproduce both sexually and asexually. The most reliable
Kryger [21]
I believe the answer is habitat location
5 0
3 years ago
Assigning humans to discrete categories based on common ancestry is known as ______ and was once a main way that scientists stud
Ne4ueva [31]

Answer: Racial classification

Explanation: Racial classification can be defined as the way humans are classified based on their physical and social traits which they have such as how they look, their skin color, hair texture, the native languages they speak.

Scientists used racial classification to learn how unique and different humans are.

7 0
3 years ago
Why is it important that the cell's dna is replicated before cell division?
IrinaK [193]
The cell’s DNA is replicated or copied before cell division because it is important for the cell to have 2 DNA molecules because the cell is going to divide into 2. Each new cell need a 1 DNA
8 0
3 years ago
Read 2 more answers
An overlap in the niches of two species will most frequently result in interspecific cooperation A a hybridization of species B
lara [203]

Answer:

The correct answer is D. interspecific competition

Explanation:

Niche overlap occurs when two species share a same niche and use the same resource. So niche overlap most frequently leads to competition between these two species called interspecific competition.

So In interspecific competition, the individuals of two different species fight for the same resource present in their niche for their survival. For example, lions and leopard share the same niche because they prey on similar types of animals like deer, wild pigs, etc.

So here niche overlap lead to the competition between these two carnivores. In interspecific competition, one species is more successful than other.

5 0
3 years ago
A diploid cell has two pairs of homologous chromosomes. How many different combinations of chromosomes could there be in the gam
jonny [76]
Because there are 23 chromosomes in the haploid cells. Chromosomes from each haploid cell (sperm/egg) come together to from a diploid cell, meaning that the 23 chromosomes from the sperm have intermixed with 23 chromosomes in haploid cells of the egg so this is you answer hope this helped
6 0
4 years ago
Other questions:
  • The four bases contained in dna are _____. the four bases contained in dna are _____. cytosine, guanine, thymine, uracil adenine
    14·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • After reading the paragraph below, answer the question that follows In the North Pacific Ocean, two groups of the same species o
    12·1 answer
  • Evaluate the following statement: Volcanoes are only found along coastlines.<br><br>Please help​
    12·1 answer
  • Describes vitamin D levels and problems
    5·2 answers
  • PLEASE HELP ME WITH A BIOLOGY QUESTION !! IWLL GIVE BRAIN!,
    8·1 answer
  • (honest question) How come whenever archaeologists uncover human remains they are always male or female and not any of the other
    13·1 answer
  • Please help anyone ?????!!!
    8·1 answer
  • 8. Crossing over is an exchange of corresponding segments between nonsister
    14·1 answer
  • What is an acid?<br> What is the ph level of an acid?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!