1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
9

Is 1.15 a rational number

Mathematics
1 answer:
iragen [17]3 years ago
6 0

Answer:

No

Step-by-step explanation:

The given number is 1.15. Here, the digits after the decimal are terminating, so the given number is rational, NOT irrational. Thus, 1.15 is NOT an irrational number.

You might be interested in
PLEASE HELP ANYONE.....
irga5000 [103]

Answer:

the awnser should have is. b

8 0
2 years ago
Read 2 more answers
List the following fractions from least to greatest
jonny [76]

Answer:

It would be number 3. 1/7,3/7,4/7,6/7

Step-by-step explanation:

For fractions if the denominator is the same you go to the numerator (the top number) to compare. The bigger the numerator is (like 6) the higher it should go on your list.

7 0
2 years ago
Match the term with the definition.
Bingel [31]

Answer:

A. Perpendicular Lines

B. Circle

C. Angle

D. Plane

E. Parallel Lines

Hope this helped! Mark as Brainliest Please! :)))

Step-by-step explanation:

8 0
2 years ago
Write an equation of a line that passes through (-3,1), perpendicular to Y=-3x-3
Sever21 [200]

Answer:

4

Step-by-step explanation:

  • To be perpendicular, the product of the slope is -1.
  • (x,y) Substituting the coordinates.
  • y= 1/3(x+3) + 1
  • y= 1/3x +2
5 0
2 years ago
Read 2 more answers
U(-3,6), V(-8, 1), W(-3,1)<br> 180° rotation about the origin
Ad libitum [116K]

Answer:

<em>U'</em>(3, -6), <em>V</em><em>'</em>(8, -1), <em>W</em><em>'</em>(3, -1)

Step-by-step explanation:

According to the <em>180°-rotation rule</em>, you take the OPPOSITE of both the y-coordinate and x-coordinate:

<u>Extended Rotation Rules</u>

270°-clockwise rotation [90°-counterclockwise rotation] >> (x, y) → (-y, x)

270°-counterclockwise rotation [90°-clockwise rotation] >> (x, y) → (y, -x)

180°-rotation >> (x, y) → (-x, -y)

I am joyous to assist you anytime.

7 0
3 years ago
Other questions:
  • 4. Find each quotient. a.18/-3 b.-5/-1 c.24/-6 d.-10/-1 e.-25/5 f.8/-2
    15·1 answer
  • What is the value of 1/2 x3 + 3.4y when x = 2 and y = 5<br><br> Thanks
    14·2 answers
  • What is the measure of angle z in this figure? Enter your answer in the box. z = ° Two intersection lines. All four angles forme
    9·2 answers
  • For one photography session, Dexter earns no less than $50, but no more than $100. Which inequality can be used to represent his
    7·2 answers
  • Somenone help im faling horribly there is two qestion I need help on any one know both
    10·1 answer
  • Pleaseeeee help me with this!zn
    5·1 answer
  • Lines p and q are parallel. Solve for x.
    6·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find side AB and round your answer to the nearest hundredth, help please.
    10·1 answer
  • 1
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!