1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KonstantinChe [14]
3 years ago
15

Which of the following is a fossil fuel?

Biology
2 answers:
Katarina [22]3 years ago
4 0

Answer:

B) gasoline

Explanation:

yes

rusak2 [61]3 years ago
4 0

Answer:

gasoline

Explanation:

it's it's a natural field such as a coal or gas formed in the gorge Alaska space for the remains of living organism organism he's going to be like

You might be interested in
What is the difference between a control group and an experimental group?
Serjik [45]

Control Group: Group that is being controlled .This group doesn´t receive the treatment from the researchers

Experimental Group:Group that is being Experimented and that receives the testing

3 0
3 years ago
Read 2 more answers
Hybridomas, which produce monoclonal antibodies, are made by fusing cells of the immune system with.
yuradex [85]

Monoclonal antibodies are made by the fusion of cells of the immune system with B lymphocytes and myeloma cells.

<h3>What is Hybridoma technology?</h3>
  • It is one of the best technologies that is used to produce the monoclonal antibody.
  • In this hybridoma technology the B lymphocytes that are antibody producing are isolated from a source after the immunization with a specific antigen and then are fused with myeloma cell line to form hybrid cells that are also called as hybridoma cell lines.
  • The hybridoma cell lines are then cultured in the laboratory with specific antigen and then the monoclonal antibodies are produced.
  • This can be done in in-vivo or in-vitro condition.
  • This method is preferred over all because the production of antibodies by this method is good as the antibodies produced are of high purity and highly sensitive and specific.
  • These cell lines can also be preserved for a long time.
  • Hybridoma technology has resulted in production of different varieties of monoclonal antibodies with specificity with specific antigens as the monoclonal antibodies are produced by single parental B cells.

To know more about Antibodies visit:
brainly.com/question/13299860

#SPJ4

6 0
1 year ago
Which is a product of the Krebs cycle<br><br> A. ADP<br> B. NADH<br> C. pyruvate<br> D. glucose
brilliants [131]

Answer:

B. NADH

Explanation:

For one cycle, two molecules of carbon, three molecules of NADH, one molecule of FADH2 and one molecule of ATP or GTP are produced.

3 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Fossils up to 75,000 years old can be dated with ______.
kodGreya [7K]
Fossils up to 75,000 years old can be dated with Carbon-14.
 
Radio isotopes can be used for the age determination of the fossils. Carbon-14 is a common isotope which is used for that purpose. But the half- life of the Carbon-14 is relatively small as 5730 years. That means the amount of Carbon-14 will be half after every 5730 years. Hence, decay is very fast. So Carbon-14 cannot be used forage determination which is more than 75000 years due to the low accuracy.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Do all the subatomic particles participate in chemical reactions?
    15·2 answers
  • A person with a genotype of HbSS has sickle cell disease. A person with a genotype of HbAS allele carries the sickle cell trait.
    15·2 answers
  • WILL GIVE BRAINLIEST. AND 50 POINTS. Question 9 (1 point)
    14·1 answer
  • What's one way that humans respond to their environment that is similar to protists like paramecium?
    5·1 answer
  • Some vectors such as puc18 and others of the puc series contain a large number of restriction enzyme sites clustered in one regi
    6·1 answer
  • Reactions that produce energy are said to be
    14·2 answers
  • What is photosynthesis​
    6·2 answers
  • Photosynthesis occurs in two major stages. Which statement describes the name and function of the first stage of photosynthesis?
    5·2 answers
  • Which statement correctly distinguishes DNA and RNA?
    12·1 answer
  • ____________ is often criticized by both heterosexuals and lesbian/gay individuals as indicating promiscuity, indecisiveness, or
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!