All of the above-mentioned facts are the risks that pests pose to the consumers. Pests are unwanted insects, which may infect food, as they are laden with pathogenic micro-organisms, they eat away the stored food, as a source of nourishment, and are difficult to manage. Pesticides are used to kill the, and they are chemicals, which may also pose serious threats, if consumed in large quantities.
Hi! human,dog are multicellular organisms. Nucleus,cell membrane, cytoplasm and mitochondria are 4 things that plant and animal cells have.
Answer:
a. It is a dihybrid cross
b. 0%
c. 0%
d. 0%
e. 100%
f. 0%
g. 0%
Note: Answers are given assuming that hhRD = hhDD
Explanation:
a. The cross, HHdd x hhDD is a dihybrid cross involving two traits: fruit colour and fruit shape
2. Gametes produced in the cross are given below:
for HHdd= Hd and Hd
For hhDD = hD and hD
Offspring produced in the cross:
All HhDd, which represents white and the flattened disc-shaped fruit white since They are both dominant characters.
b. Percentage of the offspring from this cross expected to have the HHDD genotype = 0%
c. Percentage of the offspring from this cros expected to have the hhDD genotype = 0%
d. Percentage of the offspring from this cross expected to have the HhDd genotype = 0%
e. Percentage of the offspring from this cross are expected to produce white and disc-shaped fruits (HHDD or HhDD or HhDd) = 100%
f. Percentage of the offspring from this cross expected to produce white and spherical fruits (HHdd or Hhdd) = 0%
g. Percentage of the offspring from this cross expected to produce yellow and disc-shape (hhDD or hhDd) = 0%
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
