1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
joja [24]
2 years ago
15

Select the answer that shows all the words that should be capitalized in the sentence.

Biology
1 answer:
ivann1987 [24]2 years ago
6 0
D, Pennsylvania, Gettysburg, Address
You might be interested in
Why does an autopsy include an examination of all the body systems and not just the suspected cause of death?.
Ber [7]

An autopsy includes an examination of all body systems as the suspected cause of death may be inaccurate. Everything should be analyzed in case there is a medical problem anywhere in the body that may have caused the death.

To know the full story of death you have to watch it all. Autopsy also called postmortem examination or autopsy is the dissection and examination of a cadaver and its organs and structures. An autopsy, or necropsy, has been the gold standard for discovering the cause of death and examining disease in this regard for centuries.

An autopsy may be performed to determine the cause of death observe the effects of the disease and determine the course and mechanism of the disease. The exact nature of a death can be difficult to prove how it happened. Visible evidence of how the death occurred is not always necessary and can be used as a diagnostic tool. No medical history is required.

Learn more about The Cause of death here:-brainly.com/question/23292552

#SPJ4

7 0
1 year ago
What is the double helix?
WARRIOR [948]
A pair of parallel helices intertwined about a common axis, especially that in the structure of the DNA molecule.

that is the definition^
4 0
3 years ago
On which surfaces did you move the box easily?
faust18 [17]

Answer:

water

Explanation:

because the surface of water is slippery

4 0
3 years ago
Read 2 more answers
Which scientists are credited for the events described in the development of the cell theory
Alex Ar [27]

Answer: Robert Hooke, Theodor Schwann, and Matthias Schleiden

Explanation:

3 0
2 years ago
Does access to condoms prevent teen pregnancy?
Nady [450]
Yes
It does
Or so that is what we are taught
7 0
3 years ago
Other questions:
  • Hat are the two major methods of cellular division in eukaryotic cells?
    8·1 answer
  • Hazardous substances ______________ whereas toxins are ______________.
    10·1 answer
  • Choose the equation that represents an exponential function that passes through the point (2, 36).
    10·2 answers
  • Of the more than 35 animal phyla, the ____________ are considered the most successful of all animal groups.
    7·1 answer
  • What are the structures that contain the DNA of each cell? A. Ribosomes B. Golgi bodies C. Chromosomes D. Cell membrane
    12·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which is most likely to help an introduced species become invasive
    6·1 answer
  • What are sedimentary rocks that form from evaporating sea water called?
    12·1 answer
  • Outline how a hobby gardener can make and use microclimates.
    5·1 answer
  • How humans have contributed to the extinction of plant or animal species?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!