Which is considered a modern space exploration project rather than a historical or future project?

Biology

2 answers:

Llana [10]3 years ago

7 0

A.) Launch a satellite

Landing on the moon takes years to figure out. (How, when, what is the purpose, etc.) Capturing an asteroid is beyond difficult and would also take years to figure out how to do so.

Launching a space probe has yet to be done BUT we have had a satellite launched (hence how we get satellite images.)

Anit [1.1K]3 years ago

7 0

Answer:

Explanation:

You might be interested in

Why would water level drop and high plains over the years?

Yakvenalex [24]

Because it depends on the amount of humidity and perspiration produced in that area

7 0

3 years ago

What happens when sunlight hits the atmosphere

ser-zykov [4K]

Once energy from the Sun gets to Earth, several things can happen to it: Energy can be scattered or absorbed by aerosols in the atmosphere. ... Light colored surfaces are more likely to reflect sunlight, while dark surfaces typically absorb the energy, warming the planet.

3 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

How do scientific understanding, historical data, and monitoring help scientists predict weather and climate hazards?

Papessa [141]

Answer: Predicting the size, location, and timing of natural hazards is ... of understanding that can be used to predict natural hazards

Explanation:

4 0

3 years ago

1.4.2 Test (CST): Computer-Scored Unit Test

trapecia [35]

A. The data did not support the hypothesis because more people preferred tap water.

3 0

2 years ago